These are biochemistry questions:Questions are part A and B. You are studying a new operon that you have discovered in E. Coli that you have named the UpLate operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You havediscovered three genes (sleep, wings, and energy) encoded within the polycistronic templatemade from the operon. The transcription start site is indicated at the arrow and the proteinencoding sequences are encoded by the boxes with the names of the genes inside, with a blowup of the nucleotide sequence at the promoter, with the transcription start occurring at the C.(Asterisks for part F)sleepwingsenergy5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3'3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5'A. Place boxes around the -10 and -35 elements of the core promoter. What binds to theseregions of the promoter and why is it important? B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?

Answered: Image /qna-images/answer/9f8976be-6be6-444a-b5fa-19140146c157.jpg

Answered: You are studying a new operon that you…

You are studying a new operon that you have discovered in E. Coli that you have named the Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I gene affects gene expression. (ii) Explain the function of the lacP in the bacterial operon. (iii) Which part of the lac operon is cis-dominant? Explain.
The trp operon in E. coli encodes enzymes essential for the biosynthesis of tryptophan. In the operon, trpR gene encodes the repressor. A trpR repressor cannot bind tryptophan. The trpO is the operator. trpA encodes the enzyme tryptophan synthetase. For the enzyme (A), indicate with a + or-whether or not it is made when there is tryptophan and when there is no tryptophan. Without Tryptophan With Tryptophan R'O A /R* O' A R'O' A/R* Oʻ A R*OA/R' O A
Supply the words “off" or “on" in the blanks below: In an inducible operon, transcription is normally and must be turned In a repressible operon, transcription is normally and must be turned Briefly describe the overall function of the structural genes in the lac operon. Briefly describe the overall function of the structural genes in the trp operon. For the following descriptions of the bacterial lac operon, determine if lactose is present (P) or absent (A). The repressor is bound to the operator. The repressor is inactive. RNA polymerase transcribes the structural genes. Allolactose is bound to the repressor For the following descriptions of the bacterial trp operon, determine if tryptophan levels are high (H) or low (L). The repressor is bound to the operator. The repressor is inactive. RNA polymerase transcribes the structural genes. Tryptophan is bound to the repressor.
The diagram below represents the tryptophan operon with the trp leader mRNA transcript enlarged to represent the AUG translation start codon, two consecutive tryptophan amino acid codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the mRNA leader region. Suppose a mutant bacteria has region 3 of the trp operon attenuator region mutated so that it cannot base pair normally. Would the bacteria grow in the absence of the amino acid tryptophan? (hint: in order for bacteria to grow in absence of tryptophan it should be able to synthesize its own tryptophan) Leader region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence MRNA AUG UGGUGG UUUUUU 1 2 3 (tryptophan codons) There is insufficient information to answer the question. Yes No O O
The diagram below represents the tryptophan operon with the trp leader mRNA transcript enlarged to represent the AUG translation start codon, two consecutive tryptophan amino acid codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the MRNA leader region. Suppose a mutant bacteria has region 4 of the trp operon attenuator region mutated so that it cannot base pair normally. Would the bacteria grow in the absence of the amino acid tryptophan? (hint: in order for bacteria to grow in absence of tryptophan it should be able to synthesize its own tryptophan) Lead&r region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence MRNA UGGUGG 1 (tryptophan codons) AUG UUUUUU No There is insutficient information to answer the question. O Yes
The diagram below represents a hypothetical operon in the bacterium E. coli. The operon consists of two structural genes (A and B), which code for the enzymes “Aase" and "Base", respectively, and also includes P (promoter) and O (operator) regions as shown. A В When a certain compound (X) is added to the growth medium of E. coli, the separate enzymes "Aase" and "Base" are both synthesized at a 50-fold higher rate than in the absence of X. (X has a molecular weight of about 200.) Which of the following statements is true of the operon described above? The region of the A gene that codes for the carboxyl-terminal amino acid of “Aase" is near the left end of the A gene. The P region contains nucleotide sequences to which the RNA polymerase holoenzyme (including the o subunit) binds specifically but which the core enzyme does not recognize. The addition of X to the growth medium causes a repressor protein to bind tightly to the O region. The mRNA copied from this operon will be covalently…
A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*
To characterize the promoter of the gadA operon you made a series of deletion mutants removing pieces of the promoter to see what would happen. The results are found below: gad promoter gada gadX gadz 450 +1 lacz activity transcription start site pH 2.0 pH 7.0 A gad promoter beta-galactosidase (lacZ) +++ 450 gad promoter beta galactosidase (lacZ) +++ +++ 300 +1 gad promoter beta galactosidase (lacZ) 150 D gad beta galactosidase (lacz) -450 150 E gad promoter beta-galactosidase (lacZ) -450 -300 Based on these results, what can you conclude about the gad promoter? O a. The promoter is only regulated by repression Ob. The promoter is regulated by a mix of activation and repression O c. The promoter is only regulated by activation O d. The promoter has multiple operators and multiple enhancers
Imagine that a new strain of E. coli is discovered, and it contains the following novel genetic region including the lacI gene and the lac operon: *see image* Upstream of the promoter associated with the lac operon, there is a new operator element "Oν" (O-"nu"). This new operator has high sequence homology to O1, the DNA element that is bound with the highest affinity by the lac repressor. What would be the impact of this new genetic element regarding behavior of the operonin the absence (vs. the presence) of lactose and allolactose? Answer in terms of the protein levels of the lac repressor, as well as the proteins encoded by the genes lacZ/Y/A in the downstream region of the operon. Remember that proteins, once expressed/generated, will not persist forever, and that they have a natural lifetime (ending when they are degraded by the cell).
Bacterial DNA containing an operon encoding three enzymes is introduced into chromosomal DNA in yeast (a eukaryote) in such a way that it is properly flanked by a promoter and a transcriptional terminator. The bacterial DNA is transcribed and the RNA correctly processed, but only the protein nearest the promoter is produced. Can you suggest why?
Two closely linked open reading frames (ORFs) have been identified on the E. coli chromosome and they are predicted to encode genes sugX sugY which is involved in the catabolism (utilization) of a non-glucose sugar. In the figure below, the top line (with the big arrow) is the coding strand, and the bottom line is the non-coding (template) strand of the operon. Since the RNA sequence would be the “same” as the coding strand, please label (show the location of), in relation to the ORFs, the promoter(s) and 4 other genetic elements in this region that may be involved in the transcription and translation of sugX and sugY as well as the regulation of their expression. (Note: genetic elements are the regions of DNA or RNA.) If you are not comfortable with the coding strand of the DNA, feel free to draw the mRNA strand underneath and label the relevant features on the RNA strand, but the RNA strand must be aligned with the DNA strands in position and scale. Leader(s)/antileader(s) and…
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions I really need a in depth epxplantion for the queshtions to make sure i understand the answers a.What effect does lactose have on the bacterial cell’s lac operon? b.What does the absence of glucose do to the bacterial cell? c.You now add tryptophan to the cell. What would happen to the bacterial cell and its trp operon? d.What kind of regulation does lactose provide to an operon’s repressor?