These are biochemistry questions:Questions are part A and B. You are studying a new operon that you have discovered in E. Coli that you have named the UpLate operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You havediscovered three genes (sleep, wings, and energy) encoded within the polycistronic templatemade from the operon. The transcription start site is indicated at the arrow and the proteinencoding sequences are encoded by the boxes with the names of the genes inside, with a blowup of the nucleotide sequence at the promoter, with the transcription start occurring at the C.(Asterisks for part F)sleepwingsenergy5'-тстTGACАСАТСAGGCTAGCATTATAAAGсCGGCTAGCTAGCATGCAAAGCСТАССТТ-3'3' -ACAACTGTGTAGTCCGATCGTAATATTTCGGCCGATCGATCGTACGTTTCGGATGCAA-5'A. Place boxes around the -10 and -35 elements of the core promoter. What binds to theseregions of the promoter and why is it important? B. What is the first 6 nucleotides of the mRNA sequence generated at this operon?

Answered: Image /qna-images/answer/9f8976be-6be6-444a-b5fa-19140146c157.jpg

Answered: You are studying a new operon that you…

You are studying a new operon that you have discovered in E. Coli that you have named the Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which of the following statements about pH is (are) true: pH is a measure of free hydrogen ion concentration none of these are true both of these are true An increase in hydrogen ion concentration means a decrease in pH scale units
Changes to the sequence of nucleotides in DNA, or changes to chromosomes, are called
Po ~Av Αν Radioactive Thymine (գլոսյա/siunos) 500 400- 300- 200- 100- Radioactive Uracil (counts/minute) Figure 1- Radioactive Thymine E-621 3¶ = = = = 112 0- 100 80- 60- 40- 20 15 20 Time (minutes) Figure 3-Radioactive Uracil 1 1 0- 14 ted States) IT 1 5 10 5 2 10 25 25 20 15 Time (minutes) 1 30 111111 30 V g DNA in broth 35 2- 1.5- 1- 0.5- 0 3 35 Test broth with antibiotic added Control broth with no antibiotic added 1 V 40 glucose concentration to kill the bacteria. 40 Figure 5-DNA in the Broth 2.5- 5 L AaBbCcDdEe AaBbCcDdEe AaBb AaBbC Normal No Spacing Heading 1 Heading 2 Radioactive Methionine 10 (counts/minute) 30,000 25,000- 20,000- 15,000- Figure 2- Radioactive Methionine 10,000- 5,000- 0++ 500- 400- 300- 200- 100- Figure 4- Glucose Concentration 0 25 1 15 20 Time (minutes) LL MacBook Pro 1 30 5 5 f 5 35 W 20 25 15 10 Time (minutes) 10 40 6 LI 25 15 20 Time (minutes) 30 30 35 35 40 40 Foc
Using my chart can you help me with this question. The tests we used were qualitative; they allowed us to determine if a biological molecule was present or absent. In contrast, what type of information would a quantitative test provide?
Study the following urine test results and complete Tables 1 and Write “+” signs in the appropriate boxes of Table 2 to indicate different medical problems. Tests A B C D E Leukocyte Nitrite Protein pH Blood Specific Gravity Ketone Glucose Table 2: Medical Problems Indicated by Urinalysis Results Diagnoses A B C D E Urinary Tract Infection Diabetes Kidney Stone Liver Disease Kidney Disease Unclean catch
A glucose monitor is an instrument that diabetics use to check their blood sugar. To use it, you insert a 'test strip' into the monitor and apply blood to it, then the blood is sucked into the instrument and the concentration of the sugars in the blood are measured. Like most instruments, it isn't 100% accurate 100% of the time. The informational pamphlet includued with the test strips say that a sample with a concentration of 7.2 mg/ml will give a reading with a standard deviation of 0.2 mg/ml. This means that when measured, a sample of blood with a 7.2 mg/ml glucose concentration will give a reading between mg/ml % of the time. mg/ml and
What is meant by "selective toxicity"