You are interested in the evolution of stress responses in a tropical bird - "species 1." This species has a closely related species found in Minnesota (species 2), where the breeding season is very short. In the tropics, species 1 can potentially reproduce year-round. How might you predict the stress responses of the species to differ in terms of cortisol expression following a brief stressor (e.g., exposure to predator or food restriction)? Cortisol levels Species 1 Species 2 B Species 1 Species 2 TIME C Species 2 Species 1 D Species 2 Species 1
Q: Direct repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision.…
A: Escherichia coli, commonly abbreviated as E. coli, is a gram-negative, rod-shaped bacterium that is…
Q: Please indicate the amount of Lidocaine you would use for each quadrant of the patient's mouth…
A: Introduction A local anaesthetic called lidocaine is frequently used in veterinary dentistry to…
Q: Heterochromatin consists of a) region of euchromatin devoid of histones. b) an AT-rich region…
A: Chromatin is the complex of DNA, histones, and other proteins that make up the genetic material of…
Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…
A: Genes are hereditary structures on genetic material. These control some specific particular traits.…
Q: The introductory passage describes the identification of eukaryotic signature genes in…
A: Defining life can be challenging, as there are many different characteristics and properties that…
Q: Are articular and hyaline cartilage the same thing?
A: A strong, flexible connective tissue which protects our joints and bones is known as Cartilage. It…
Q: an intermediate in glycolysis. Glycerol backbone of a fat molecule can be converted to…
A: Oxidative phosphorylation is a process of formation of ATP from oxidation of fat, carbohydrates and…
Q: elect all examples of mutations that are likely to e dominant to wild-type alleles. elect all…
A: Dominant mutations are those mutations which are either present in the homozygous or heterozygous…
Q: 1) Dr. Velazquez considers targeted mutagenesis of DNA ligase. What would that do? a) Prevent…
A: INTRODUCTION DNA ligase DNA ligase is an enzyme that can join DNA fragments by catalyzing the…
Q: Mature synapses distinguished from embryonic synapse by their a) longer postsynaptic potentials. b)…
A: Introduction: Embryonic refers to the earliest stages of development in an organism, from…
Q: In the reaction, C6H12O6 + 6 O₂ -> 6 CO2 + 6 H₂O which side should energy be placed on? O The left…
A: An endergonic reaction is a chemical reaction that requires an input of energy in order to…
Q: The patient has a significant decrease in blood hemoglobin. No blood loss was observed. Diet and…
A: Introduction Hemoglobin (often spelled haemoglobin) is a protein molecule found in red blood cells…
Q: You are given the biochemical pathway below. Seven mutant strains (labeled S1-S7) are defective in…
A: The answer of this question will be option c, None of these.
Q: ar 20 1 copy producing make whelin nd sporophytes th plants w Home Insert Draw Design Transitions B…
A: The slide is discussing the group of plants known as vascular, spore-producing plants, which…
Q: These figures show that: S Vor (1-min¹) 30 A 2.5 20 1.5 1.0 0.5 (50) 10 Concentric Eccentric…
A: There are 2 types of isotonic muscle contractions: concentric and eccentric. Eccentric contraction…
Q: . Chloroplast is responsible for the reactions of photosynthesis true or false?
A: Photosynthesis can be defined as the process in which the green plants and other organisms convert…
Q: 4. Pick the first and second solutions the author has presented to get rid of exhaustion and…
A: The comprehension provided discusses the importance of a healthy lifestyle. The author explains the…
Q: The part of a eukaryotic cell that produces secondary, tertiary, and quantenary proteins are ______.
A: Introduction: Ribosomes are complex molecular machines that are found in all living cells, including…
Q: Which of the following would result in offspring MOST genetically similar to its parent? a whiptail…
A: The correct answer is (d) an aphid arising from asexual reproduction. Asexual reproduction involves…
Q: Part A. If you were to expose cells that are undergoing anaerobic respiration to a radioactive…
A: Introduction Cellular respiration is the metabolic process by which cells convert nutrients into…
Q: What makes for faster muscle? At what cost? Answer this both for fast-twitch compared to…
A: Fast-twitch muscle fibers are specialized for generating rapid, powerful contractions for short…
Q: Correlate transport maxima and gradient-time limited transport in proximal tubule.
A: In the kidney, the proximal tubule is the first segment of the renal tubule. It is in charge of…
Q: What are the overall inputs (substrates and energy sources) and outputs (products and by- products)…
A: Photosynthesis is a complex process by which green plants and certain other organisms synthesize…
Q: Can natural assimilation reduce eutrophication? Is there a limit to natural assimilation? Discuss.
A: Natural Assimilation: Natural assimilation refers to the process by which living organisms…
Q: Indicate the anatomical part that should be used as reference and the nerves that are impacted by…
A: Introduction A nerve block is a medical procedure that involves injecting a local anesthetic…
Q: The spotted hyena can generate enough force with its jaws to crush bone. Which of the following is…
A: Introduction Bone is a hard, dense tissue that makes up the skeleton of vertebrates, including…
Q: A non-direct application of the study of microbes is vaccination. true or false ?
A: Introduction Microbes, also known as microorganisms, are tiny living organisms that are too small…
Q: Case study: JR 19-year-old suffers a head injury after a MVA and is being transported to the ER.…
A: Introduction The nervous system is a complex network of specialized cells called neurons, which…
Q: 5. Use the table below to describe under what conditions the lac operator is turned on and off. Is…
A: The lac operon is a single-promoter operon that is necessary for the transport and metabolism of…
Q: stages in the "information processing model" (stage 1, 2, and 3). For each of the stages, choose…
A: Information processing theory aims to explain how information is encoded into memory. So we the…
Q: Lungs: With age, lung function becomes "less efficient." Which one does not explain why? Lung…
A: Introduction :- The lungs are a pair of spongy, air-filled organs located in the chest cavity,…
Q: In studying Lokiarchaeota, researchers identified eukaryotic signature genes and used this…
A: Housekeeping genes are essential for basic cellular functions and are expressed at relatively…
Q: We discussed environmental sex determination in reptiles, where the sex of the individual is…
A: The modes of sex determination that fit the category of environmental sex determination are…
Q: Which of the following is not correct concerning plant xylem? The fluid (sap) in the xylem…
A: Xylem is a specialized vascular tissue in vascular plants that transports water and dissolved…
Q: Which one below does not describe normal age-related changes in the skeletal system? Loss of…
A: Every skeletal structure loses bone density after a certain age. Most cases happen to age-related…
Q: Which of the following is a circulatory adjustment to sustained moderate exercise? A. Constriction…
A: Sustained moderate exercise require lot of skeletal muscle contraction. For continuous muscle…
Q: According to a number of paleoanthropologists, the fossils assigned to the species Homo habilis…
A: The evolutionary process that led to the formation of Homo sapiens as a unique species of the…
Q: Describe the ways plants have evolved to deal with photorespiration?
A: Answer: When plants absorb oxygen instead of carbon dioxide during photosynthesis, a process known…
Q: What is inhibitors and type of inhibition of Phosphofructokinase and reference
A: Phosphofructokinase (PFK): Phosphofructokinase (PFK) is an enzyme that plays a crucial role in the…
Q: What are the long-term effects of smoking on the body, and how can someone quit smoking?
A: Introduction Health is a state of physical, mental, and social well-being and not merely the…
Q: Amelia tests several substances in her house to determine their pH values and records the results.…
A: pH stands for "potential of Hydrogen" and is a measure of the acidity or basicity of a substance. It…
Q: new dNTPs can be added at the start of replication, this is done by an enzyme called RNA…
A: DNA is made up of deoxyribonucleotides. DNA exist in two strands and both the strands are linked by…
Q: mRNA: amino acids: traits: DNA: | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG |…
A: The process of synthesis of mRNA with the help of DNA template is called transcription. This step is…
Q: Pls. suggest a unique research or experiment in relate to biology
A: One unique research or experiment in biology could be exploring the potential of using CRISPR-Cas9…
Q: The following is the net reaction for which step in respiration (assume that NADH/H+ and FADH2 are…
A: Cellular respiration is the process by which cells convert glucose and other nutrients into usable…
Q: How do I describe evolution of genesv represented by protein sequences?
A: Genes are segments of DNA that contain the instructions for building and maintaining an organism.…
Q: M Question: If you perform a Chi-square goodness of fit test, what is the value of Chi square X²…
A: Chi-square Goodness of Fit is a statistical test that allows us to compare observed data with…
Q: In E. Coli, which enzyme is responsible for removing and correcting mistake individual nucleotides…
A: Escherichia coli, commonly abbreviated as E. coli, is a type of bacteria that is commonly found in…
Q: Characterize and identify the Genus of the following cyanobacterium Genus Identification of…
A: Cyanobacteria, also known as blue-green algae, are a group of photosynthetic bacteria that obtain…
Step by step
Solved in 2 steps
- The brown-nosed tweety bird can be found in both urban and wild environments. Researchers collected 100 birds from a forest, and divided them into two groups of 50 birds, each with 25 males and 25 females. One group was released into the forest and the other into a nearby city. After 1 year, a group of hardworking students collected all 100 birds and measured stress indices associated with signalling by their "stress glucocorticoid hormone", corticosterone (a steroid). They find that compared to the forest birds, the urban birds have greater levels of a stressed phenotype. Which of the following observations is MOST LIKELY to be part of the explanation for this observation? The urban birds have similar levels of corticosterone, but higher levels of the membrane receptor for this glucocorticoid The urban birds have genetic differences in their glucocorticoid receptor to give it higher affinity, making them more sensitive to corticosterone. The urban birds have lower expression of genes…From the diagram, !shortly! explain how this hormone cascade promotes homeostasis.In order to resist long-term stressors, glucosteroids increase ________ in blood.
- Endocrinologists, scientists and medical doctors who study how hormones work in the body, can track reproductive hormones in female mammals to determine when and how much of each of the hormones listed in the table above are present in the body Tracking the leveis of hormones and when they are released provides valuable information for developing tests that can predict when events, like ovulation, will occur 5. Given the information in the table above, identify at least threo hormones that, if tracked, would be good indicators that ovulation is about to occur ina female giant panda. WCinizing hoYYmone (LH it IS the production tyiggering vel M the follicie.- Follice Shmulahng hormone (FSH) Promotes the graw Dlicies in the Ovary that produce cstrogçn 8 EStYogen: Prepaves the ui cal implantation of 'an cmbhyo after fertilizatian takes place. In order to best support panda reproduction by natural mating and artficial insemination, highly sensitive and specific tests are wdaoeded to…Explain on how Pituitary-dependent hyperadrenocorticism (PDH) happen in a dogs that have excess of endogenous glucocorticoid in the body.Hashimoto’s disease is an autoimmune disease where the body’s immune systemattacks the thyroid gland, preventing it from functioning properly. Often times, a verylarge number of white blood cells will accumulate in the thyroid gland and resultin hypothyroidism. Q1. A change in hormone level that would be expected in individuals affected by Hashimoto’s disease is a. an increase in TRH and TSH, leading to a further decrease in the rate of metabolism b. a decrease in TRH and TSH, leading to a further decrease in the rate of metabolism c. a decrease in TRH and TSH, leading to additional symptoms such as goitre d. an increase in TRH and TSH, leading to additional symptoms such as goitre
- QUESTION 1 Which statement is accurate? Hormones that differ in effect reach their target cells by different routes through the body Pairs of hormones that have the same effect are said to have antagonistic functions Hormones are often regulated through feedback loops Hormones of the same chemical class usually have the same functionScientists have noticed a disturbing trend in the freshwater ecosystems in North America: a large number of male fish are found to contain female egg cells growing inside their testes. The feminization of male fish is called intersex, and its exact cause is still baffling many scientists. Many studies have shown that intersex can be induced when male fish are exposed to endocrine disruptors. An endocrine disruptor stimulates or inhibits the endocrine system, causing either an increase or decrease in hormone production. However, it is easier to demonstrate the direct cause and effect in a laboratory environment where the fish are only exposed to a single endocrine disruptor. In nature, there are many other variables such as low oxygen levels or warmer water temperatures that could also cause feminization in fish. What can we, as a society or as individuals, do to protect our ecosystems and watersheds from endocrine disruptors?Scientists have noticed a disturbing trend in the freshwater ecosystems in North America: a large number of male fish are found to contain female egg cells growing inside their testes. The feminization of male fish is called intersex, and its exact cause is still baffling many scientists. Many studies have shown that intersex can be induced when male fish are exposed to endocrine disruptors. An endocrine disruptor stimulates or inhibits the endocrine system, causing either an increase or decrease in hormone production. However, it is easier to demonstrate the direct cause and effect in a laboratory environment where the fish are only exposed to a single endocrine disruptor. In nature, there are many other variables such as low oxygen levels or warmer water temperatures that could also cause feminization in fish. Identify two reasons why we should be concerned about the feminization of fish.
- Scientists have noticed a disturbing trend in the freshwater ecosystems in North America: a large number of male fish are found to contain female egg cells growing inside their testes. The feminization of male fish is called intersex, and its exact cause is still baffling many scientists. Many studies have shown that intersex can be induced when male fish are exposed to endocrine disruptors. An endocrine disruptor stimulates or inhibits the endocrine system, causing either an increase or decrease in hormone production. However, it is easier to demonstrate the direct cause and effect in a laboratory environment where the fish are only exposed to a single endocrine disruptor. In nature, there are many other variables such as low oxygen levels or warmer water temperatures that could also cause feminization in fish. Name two endocrine disruptors, identify their source and explain how they can get into freshwater bodies? An example has been given. Endocrine Disruptor: DDT…Compare and contrast how the endocrine and neural systems do long- distance communication within the mammalian body. State and be able to recognize the roles of neurons and various types of glia (astrocytes, oligodendrocytes, Schwann cells, microglia). Give two mechanisms for how different target cells exposed to the same hormone can respond in different ways. Predict how perturbations to the hypothalamus, pituitary gland, thyroid, the hormones they secrete, or iodine levels will affect hormone levels, thyroid size, metabolic rate, and intelligence in children. Distinguish between asexual and sexual reproduction. Discuss how the environment, sex chromosomes, sex- determination genes, hormone levels, and anatomical features can contribute to sex determination in people or other organismResearchers measured prolactin and growth hormone in the blood plasma of six subjects at regular intervals over a 24-hour period. The investigators were interested in determining if the levels of these two hormones cycle over a 24-hour period. The Figure presents the results of their experiments, with the y axis values showing the amount of each hormone expressed as a percentage of the 24-hour mean value, and each point showing the average of the six subjects levels. FIGURE Mean concentrations of prolactin and growth hormone in plasma, averaged for six subjects and expressed as a percentage of the average concentrations measured for the 24-hour period. Do the results support the hypothesis that the changes in prolactin level over a 24-hour period are associated with the sleepwake cycle? Source: From J. F. Sassin et al. 1972. Human prolactin: 24-hour pattern with increased release during sleep. Science 177:12051207.