Answered: With respect to the Multiple Sequence…

With respect to the Multiple Sequence Alignment software tool, ClustalW, briefly give an overview of the 3 steps involved in generating a Multiple Sequence Alignment

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 11TYK

See similar textbooks

Related questions

Q: The cochlear apex is: Not associated with a topographical mapping of frequency Where the helicotrema…

A: Option C is the correct answer.Explanation: Hair cells have cochlear nerve which contains axons and…

Q: Q1. Science can be conducted using experiments or by observation. In both cases, one can deduce…

A: Observation is a vital piece of science. It allows us to see the aftereffects of an experiment,…

Q: How does mutation can affect the central dogma and the phenotype?

A: Mutations are the changes in the DNA sequence. The changes can be single base changes or a fragment…

Q: Do the bottom diagram Find all th calculations Micrograph width is 0.2mm at 400x Draw a micrograph…

A: at 1000x magnification = 1.78mm x 100 divided by 1000 = 0.178 mm or 178 micrometers. Stage…

Q: 9.Which among the following choices lists the three phases of the ovarian cycle in the correct…

A: Ovarian cycle is a series of events that happens during a period, which contains the follicle…

Q: Construct a Table to show the differentiation of the Germ Layers: ( It is a known fact…

A: Introduction The process of forming and developing an embryo from a zygote or a somatic cell is…

Q: 1 mL of a juice sample is taken and diluted in 9 mL culture medium, subsequently, this suspension is…

A: Petroff- Hausser chamber is a chamber used usually for sperm and bacterial count. Number of bacteria…

Q: Animal phylogenies based on molecular and

A: 1) Phylogenetic trees basically reconstructed from different genes in the same organism. However it…

Q: THERMAL RADIATION - HEAT LOSS OCCURS DUE TO 1. due to the evaporation of sweat from the surface of…

A: Conduction, convection, and radiation are the three methods for transferring heat. The direct…

Q: What is the term that describes the ability of a virus to cross the blood-brain barrier and infect…

A: A virus, an unseen microorganism, infiltrates our body. It infiltrates our tissues and then…

Q: The role of the ossicles is to of vibrations Decrease the intensity Increase the strenght O Change…

A: Introduction :- The auditory ossicles are three bones in each middle ear that work together to…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: Which of the following would not be considered a polymorphism? O A) Phenotypic traits that vary in…

A: The external characteristics of an individual is known as phenotype which is controlled by genes. In…

Q: i need the answer quickly

A: The heat transfer method is divided into three types: conduction, convection, and radiation. Heat is…

Q: You have a population where you know people's MN blood types. (Mand N are co-dominant.) 50 people…

A: The allele frequencies can be calculated by observing the number of individuals in each genotypes.…

Q: Which of the following statements concerning photoreceptors is not correct cones produce colored…

A: Introduction The retina is a light-sensitive layer of tissue at the rear of your eye that delivers…

Q: The amount of light entering the eye is determined by the size of the: O The pupil O The lens O The…

A: Pupil present in the center of iris .The amount of light entering the eye control by the size of…

Q: The following statements are true except a. Founder-controlled communities are those in which there…

A: Primary succession happens in basically barren areas where the soil is unable of supporting life due…

Q: Don't copy from internet. Thanks!! 1. When does the food chain starts? How come it never exceeds…

A: Food chain refers to the sequence of events in an ecosystem where one living organisms eats other…

Q: Label the parts of the chick embryo

A: Parts Of The Chick Embryo oropharyngeal membrane angiogenic cell cluster Ectoderm Endoderm…

Q: d) Briefly describe the following: Know about the inheritance of sex-linked disorders Know how the…

A: Animal habitat refers to the environment in which they dwell. Food, water, and other necessities are…

Q: What is the significance of fertilization and how does it restore diploidy?

A: Fertilization is the process of fusion of haploid male gamete or sperm with a haploid female gamete…

Q: Draw and describe the two types of fertilization. Which representative chordates exhibits each type…

A: Reproduction is the biological process of producing offspring for their parents. It is an essential…

Q: Is it possible for RNA polymerase to continue to transcribe a gene if Lox sites and stop cassette…

A: if Lox sites and stop cassette are inserted between a promoter and its gene and here if Lox sites…

Q: A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type…

A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…

Q: Using the following hypotheses, formulate a testable prediction for each. HYPOTHESIS: When planted…

A: Asparagus Beetle is an important pest of asparagus plant. It needs to be controlled otherwise it…

Q: How are Ca2+ channels involved in phototransduction? they cause neurotransmitter release even if no…

A: Introduction The sensory transduction of the visual system is called visual phototransduction. It is…

Q: select the example of bottleneck effect.

A: A) Bottleneck effect is example of genetic drift when size of population reduced by events like…

Q: Which of the following is true of this individual? Answers A - D A The individual suffers from…

A: Trisomy means the person has three copies of chromosomes instead of two. Monosomy means one…

Q: Which molecule(s) is directly activated by Ras-GTP? A. Gene regulatory proteins B. ERK (MAP kinase)…

A: Ras protein belongs to a class of small GTPase protein, which mainly functions in transmitting…

Q: Cocaine is a drug that acts by blocking dopamine transporters, the proteins responsible for the…

A: Cocaine is a drug that is highly addictive, it increases alertness, attention, and energy. It is an…

Q: Which of the following scenarios does not contribute to the resting membrane potential? O Plasma…

Q: Development of insects are affected by many factors. Cite three major influencers and state how they…

A: Insects are the class of organisms that belong to the Phylum Arthropoda. Like any other Arthropod…

Q: The discharge rate of an off-center ganglion cell: O is not an absolute measure of light intensity…

A: Ganglion cells are the major output cells of the retina. Their axons gather at the optic disk, where…

Q: SECONDARY PREVENTION BTOРИЧНАЯ ПРОФИЛАКТИКА 1. early diagnosis of diseases, the adoption of the…

A: Secondary prevention is one of the preventive measure which aims to mitigate the impact of a…

Q: How many sets of human chromosomes are in each of the following cell types? a. an oogonium b. a…

A: INTRODUCTION Chromosome It is a thread like structure present inside the nucleus contains protein…

Q: EVAPORATION - RELEASE OF HEAT 1. in the presence of fences and objects having a lower surface…

A: When a liquid transforms into a gas, it is called evaporation. It's easy to see when puddles of rain…

Q: Which statements are true? Explain why or why not.1 Although lipid molecules are free to diffuse in…

A: The molecules or chemicals which occur naturally in living organisms are known as biomolecules. The…

Q: Describe how a molecule of RNA is synthesized using a DNA molecule as atemplate.

A: Introduction :- Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that…

Q: Explain the correlation between gas pressure and concentration in terms of respiration.

A: Respiration can be defines as the process of exchange of gases i.e., oxygen and carbon dioxide. This…

Q: Which symptoms would be present in a case of aldosterone hyposecretion? O low metabolic rate O low…

A: Autonomous aldosterone hypersecretion leads to hypertension and hypokalemia. ACTH means…

Q: Explain the role of Ras.GTP and Rac.GTP in the formation of active AP-1 during T- cell activation.

A: T cells are produced in the thymus and are primed to recognize a certain foreign particle (antigen).…

Q: According to Charles Darwin, organic evolution is "descent with modification," which simply means…

A: Charles Darwin, a British naturalist proposed the theory of organic evolution by natural selection.…

Q: Full or partial limblessness has evolved many times invertebrates (snakes, lizards, manatees,…

A: Evolution is the process of change over time, typically involving gradual changes that lead to new…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Ans: Amino acids are C - terminus and N -terminus. 2. In endoplasmic reticulum, attachment of…

Q: A change in the open reading frame that results in a different protein sequence is called a…

A: Introduction :- A mutation is a change in an organism's DNA sequence. Mutations can occur as a…

Q: QUESTION 7 Why was it necessary to use castrated rats in the experiment? O to eliminate the effects…

A: Castration is the process of removal of testicle from the body of an organism.

Q: Provide one example of each microtechnology and nanotechnology in healthcare, especially ones that…

A: Microtechnology includes techniques that makes use of processes and objects at a micro level. The…

Q: How much of the human genomesequence is functional, and why is theremainder retained?

A: In any organism, the genome is the whole set of DNA (haploid set of chromosomes) present in them. It…

Q: DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG|| MRNA: amino acids:

A: As per our company guideline we are supposed to answer only first queation . So kindly repost other…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

1. With respect to the Multiple Sequence Alignment software tool, ClustalW, briefly give an overview of the 3 steps involved in generating a Multiple Sequence Alignment. 2. "Incidences of Horizontal Gene Transfer are rare in Candida species belonging to the CTG clade". Briefly discuss this statement providing evidence whether it is correct or incorrect. 3. With respect to genome assembly, define the following terms: A. Read B. Paired and read C. Contig

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

list and explain two strategic between the shotgun sequences/ assemble strategy for whole genome sequencing and our approach to s cerevisiae genomics
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
Explain:a. functionalization of a sensor array with DNA oligonucleotide capture probes for ribosomalRNA (rRNA) species-specific sequences.b. sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe.
4a2)The xyz gene product, encoded by a new viral strain, has corresponding humanhomologs. Blast analyses revealed various human viral-related gene products of874 amino acids residues. Using the default matrix in BlastP program to performa pairwise sequence alignment between xyz gene product and its correspondinghuman homolog, the following data was obtained: What would be the effect of changing the scoring matrix from the defaultmatrix to PAM30? Replicate the above table and indicate whether the score,E value, identity and positive values will increase, decrease or remains thesame as the values given in the table above. Justify your answers.
1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50
Describe the approaches used to sequence the genomes of yeast (Saccharomyces cerevisiae) and human, and list some of the main findings from the genome sequences. Do NOT include a description of DNA sequencing methods (e.g. Sanger sequencing).
For a coding gene, purifying (negative) selection will result in more synonymous (silent) site changes when compared to the nonsynonymous (replacement) site changes. 1)True 2)False
Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the base of this analysis technique?
1. Examine the “RNA-Seq Coverage” and the “FlyBase Genes” tracks in the Genome Browser from left to right. At approximately which coordinate (base position) does the RNA-Seq data start? Remember that you can use the navigation controls at the top of the page to zoom in to the region of interest.
2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАC GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAA O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC
2) How can the construct with Cas9 and gRNA sequence be removed from the plant in case it was inserted into a genome?
4) List 3 things that a potential vector must have in order to be useful. 5) Sometimes the gene for the enzyme glutathione-S-transferase (GST) is used in purifying your protein of interest. Briefly explain how this is done. 6) What enzyme is used to create CDNA from MRNA?