Don't copy from internet. Thanks!! 1. When does the food chain starts? How come it never exceeds more than 6 organisms? 2. What are the 3 ecological pyramids? Relate the 3 pyramids on the food chain.
Q: B) Large scale clinical trials infecting human with pig whipworm were halted because those in…
A: Worm therapy is a kind of alternative treatment which has been searched in order to fight from…
Q: Answer the question in three paragraphs. (Introduction, Body and Conclusion) 1. What is the…
A: Pathogenic organisms found in the environment cause infectious diseases. They retain the ability to…
Q: Is it possible for RNA polymerase to continue to transcribe a gene if Lox sites and stop cassette…
A: if Lox sites and stop cassette are inserted between a promoter and its gene and here if Lox sites…
Q: transmission electron micrographs during viral infection cycles of both in vitro and in vivo…
A: Electron micrographs are obtained with the help of electron transmission microscope. It helps in the…
Q: Minerals are normally being absorbed in the large intestine
A:
Q: 7. Which of the following statements about terpenes is NOT true? a. They are a type of terpenoid. b.…
A: 7- All statement are correct except d. They all contain oxygen. Terpenes are the type of terpenoids…
Q: Modified True or False: Write CMB if the statement or question is correct. If the statement or…
A:
Q: Describe the distinguishing characteristics of fungi.
A: Introduction Fungi are unique species characterised by their own biological kingdom, which means…
Q: Do blood donors have their blood counts taken? Why or why not?
A: A complete blood count, also referred as a full blood count, is a series of clinical lab tests which…
Q: Which molecule(s) is directly activated by Ras-GTP? A. Gene regulatory proteins B. ERK (MAP kinase)…
A: Ras protein belongs to a class of small GTPase protein, which mainly functions in transmitting…
Q: (iv) The layer of the eyeball that forms the transparent Cornea.
A: Introduction :- The cornea is the transparent outer layer of the eye. The cornea aids in focusing…
Q: What is stress? Explain how stress develops and the causes of stress. What are the effects of stress…
A: Stress is an natural emotional feeling happens whenever a thought of something makes you feel…
Q: In addition to observing similarities to the lac operon, you also notice that this gene is regulated…
A: Transcriptional attenuation negatively regulates the expression of many operons in bacteria by…
Q: What virus current, past or new emerging/reemerging virus should he world be most concerned about?…
A: Viruses are very small and can not be seen with a light microscope, except for the poxvirus, the…
Q: crown-of-thorns starfish outbreaks on coral reefs.
A: The crown-of-thorns starfish, is a large starfish that preys upon hard, stony, coral polyps. The…
Q: give an example and explanation of how niche differences related to diet are manifest in differences…
A: Niche: The biological niche is the sum total of all the ecological requisites and activities of…
Q: If a quantitative trait follows a continuum, this means that:
A: A phenotype that can be measured is referred to as a quantitative trait. Genes, environment, or the…
Q: 2. When the enzyme telomerase was discovered, some termed it the "foundation of youth", as it is…
A: Telomerase are the enzymes also known as telomere terminal transferase is the enzyme made of protein…
Q: Food Science/ Bio
A: In healthy adults, proteins make up relatively 15.% of body mass and it is responsible for most of…
Q: Which cytoarchitectural component of the cerebellum contains predominately neuronal processes,…
A: The correct option is B that is purkinje cell layer.
Q: Use the Gizmo to create another carbon path, starting and ending in the atmosphere. Label each…
A: Biogeochemical cycle is a route involving transfer elements between living components as well as non…
Q: give 5 facts about chameleon and what is the importance of their ability to camouflage
A: Wild chameleons spend their day to day routines experiencing alone in the trees. At the point when…
Q: Find and describe 5 animal that uses camouflage and identify what camouflage tactics they use
A: INTRODUCTION Another adaptation that aids an animal's survival in its environment is camouflage.…
Q: With reference to the Penman-Monteith 56 equation, discuss how the leaf/canopy and climatic factors…
A:
Q: what does the flowers change in appearance tell you about how water moves though them in…
A: Transpiration is a cycle that includes loss of water vapor through the stomata of plants. The…
Q: Differentiate the following treatments based on the effect of light on monggo (Vigna radiata) seed…
A: Monggo (Vigna radiata) is also called as Mung bean. And this grows differently to different exposure…
Q: What is cutis anserina? Why is it significant in our body’s thermoregulation?
A: Introduction Thermoregulation:- It is a biological mechanism that allows your body to maintain its…
Q: Write the rest of the reactions that constitute the urea cycle using structural formulas. Name the…
A: In body , there are lots of chemical reactions as well metabolic pathways takes place . These…
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: According to Charles Darwin, organic evolution is "descent with modification," which simply means…
A: Charles Darwin, a British naturalist proposed the theory of organic evolution by natural selection.…
Q: (1) A plant cell may burst when: (A) Turgor pressure equalises wall pressure. (B) Turgor pressure…
A: Introduction - Plant cells are eukaryotic, meaning that they have their own nucleus. Plant cells are…
Q: Given that the AG" values for the hydrolysis of glucose 1-phosphate and glucose 6-phosphate are…
A:
Q: Explain the process of polyacrylamide reaction, and what are the two reagents are crucial for this…
A: Polyacrylamide is defined as a mesh like matrix that is suitable for the separation of proteins of…
Q: 7. Purebred lines of wild-type fruit flies (gray body and normal wings) are mated to flies with…
A: According to question Purebred lines of wild-type fruit flies (gray body (Gg) and normal wings (Ww))…
Q: Explain the principle of Lateral Flow Devices and how it is use to dect human chorionic gonadotropin
A: The lateral flow assay (LFA) is a paper-based platform for the detection and quantification of…
Q: Cadmium ions have been shown to be selective blockers of membrane calcium channels. Suppose T…
A: Cells communicate with each other via released proteins unique to each kind. Signal transduction…
Q: For an RNA virus, what is the most important consideration? how to produce its genetic material as…
A: RNA viruses need to replicate RNA. Ten this RNA molecule act as viral mRNA. It is translated…
Q: In the twenty-first century (2001- 2100 ) the biggest challenge to our society is which virus? Ebola…
A: Viruses are very small and can not be seen with a light microscope, except for the poxvirus, the…
Q: Histological examination of a patient's lymph node showed an absence of germinal centers but with…
A: Absence of germinal centers in lymph nodes. Germinal centers are the parts of lymph nodes in which B…
Q: An increase in the reabsorption of solutes will decrease water reabsorption. True False
A: ANSWER;- True
Q: The MC1R gene affects skin and hair color in humans.There are at least 13 polymorphisms of the gene…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: 1. ionosphere 2. lithosphere 3. troposphere 4. magnetosphere 5. stratosphere
A: The atmosphere is divided into many layers depending upon the availability of air, intensity of…
Q: summarize the phases of the cardiac cycle.
A: Introduction The cardiac cycle is defined as the sequential event in the heart which is cyclically…
Q: ow does pest management differ from eradication? Cite an example of each.
A: Plant diseases have resulted in major human casualties in a number of ways. Plant disease management…
Q: 6. Depression “B" articulates with the head of what specific bone?
A: Answer :: Introduction : The Coronoid process can be defined as the triangular-shaped structure…
Q: The individual flattened stacks of membranous structures inside the chloroplasts are known as : (A)…
A: Introduction :- A chloroplast is an organelle found within the cells of plants and algae that is…
Q: What functions of the kidney can dialysis replace and which can it not? 1. Waste removal 2.…
A: The kidneys are two bean-shaped glands located from either side of your spine, beneath the ribs and…
Q: 1. When the fibrinolytic factors is not regulated by the inhibitors of the fibrinolysis, what will…
A: Note:- here i will answer only first three questions according to the guidelines of bartleby. Kindly…
Q: As you likely know, the lysosome is filled with hydrolyzing enzymes. As a result, the environment…
A: The lysosome in the cell is a membrane bound organelle, that contains a wide range of hydrolytic…
Q: What's the difference between homogenous and heterogenous pericarp? I seem can't find the difference…
A: Pericarp is ripened and variously modified walls of a plant ovary and it's composed of an outer…
Step by step
Solved in 3 steps
- Chains Questions TURN IN Hd-ons Help Last edit was 13 minutes ago + BIU A 川, 三 三 ▼m ▼ Arial 11 Primary Consumers Pika Red breasted nuthatch Edith's tree frog checkerspot squirrel Douglas's Pacific Mule deer Plants, Flowers, Nuts, Seeds, Fruit, Insects Producers and Decomposers 4. What animals does the coyote eat? 5. What does the Red-breasted nuthatch eat? 6. Do you think coyotes could survive if all the Mule deers died? Why? 7. Why might it be important for organisms to have more than one food source available in an ecosystem? 8. Based on your own knowledge of a desert ecosystem and a tropical rainforest ecosystem which do you think might have more plants and animals? Why? What factors in each ecosystem might contribute to your answer. (Answer all parts of this question completely)1. Which organism have the most supply of energy? 2. Which has the least amount of energy? 3. Why is there a decrease of the amount of energy as we go up the food pyramid? 4. Where did the energy go due to losses? 5. Which among the organism in example 2 (food web) receives the least amount of energy? (except decomposers).The position of an organism along a food chain is known as its.__________ locus location trophic level microcosm
- Which of the following is not a way that piotists contribute to the food web? They fix carbon into organic molecules They occupy the apex producer niche They enter symbiotic relationships with animals They recycle nutrients back into the carbon and nitrogen cycles.The British Antarctic Survey sends ecologists to research the feeding relationships between the organisms in Antarctica. Here is part of the ocean food web they have built up. leopard seal humpback whale killer whale sperm whale emperor penguin right whale crabeater seal albatross Weddell seal squid Adelie penguin borch Antarctic toothfish Antarctic fulmar krill starfish zooplankton (tiny animals) octopus mussel seaweed phytoplankton (tiny plants)d. highest order consumers . Name the following. 1. organisms that feed on plants -Herbivore 2 order in which energy passes from one living thing to another 1e d chain 3. it is created when food chains overlap 4. living organism that is capable of using energy from the Sun cutotrophs 5. organisms that eat both plants and animals omnivores food.web Answer these questions. 4 During the growth of a tomato plant from a seed, it increases considerably in biomass. Which materials are obtained from the environment for the growth and increase in biomass of plant? Define a niche. How is it related to habitat? Which biome do you live in? we live in four biomes.forest, desert, giassland to transfer in an energy pyramid? †ħvough troplaic level Which way does energy If birds eat insects that feed on corn, which pyramid level would birds occupy? Name all the levels shown here. B wer these questions in detail. the relative amounts of energy at each level.
- Section M: Food Pyramids 1. Suppose 10,000 units of energy are available for the grass. What is the amount of energy available for the hawk? 2. How much energy is lost at each level and what is it lost as? 3. Who has the greatest biomass in the food chain? 4. What is biomass? 5. Why does the population decrease as you move up the pyramid?. © Taina Li8. Create a food web using the following food chains Berries to Deer to Black bear Algae to Salmon to Black bear Algae to Squid to Blue shark to Humans 9. Create a Food pyramid using the terms produces and consumers along with organisms from #8. Explain the energy transfer 10. Tom goes to Max's Bistro and orders the Blue shark, which gives him 2 kCal of energy. How much energy, on average, would have been necessary in the algae plants to sustain Tom's meal? Explain how you got your answer.In the below food chain, Bubonic plague, which spread through mice, killed millions of Europeans during Middle Ages. The bacteria Yersinia pestis kills the infected mice also. Predict how the death of mice affects its prey and predators in the food chain and the ecosystem? 1 1 The grasshopper eats the plants 4 The eagle eats the snake 5 3 Food Chain 2 The mouse eats the grasshopper 5 When the eagle dies, fungi break down the body and turn them into nutrients 4 3 The snake eats the mouse
- Student Book: Voca... Communities and Resources | Vocabulary | Fill in the Blank 1. If we walk to the park instead of driving a car, we will conserve climate 2. Rice is an important i i on farms in the southern United States. 3. We can use vegetable peelings and other food waste to make compost 4. Wheat, water, yeast, and salt are the needed i to make bread. 5. The time it takes to plant and grow a crop is called the: 6. Rich soil is an important that helps crops grow.5 x core.learn.edgenuity.com/player/ + ence- SC5181 A ↑ 3 2 Mark this and retum C 6 7 8 Which of the following is a valid comparison of the net primary productivity of a salt marsh to the net primary productivity of the ocean? O The salt marsh has a higher net primary productivity because it is smaller in area and volume. O The salt marsh has a higher net primary productivity because it has higher salinity O The ocean has a higher net primary productivity because it is larger in area and volume O The ocean has a higher net primary productivity because it has more organisms producing carbon. 0 % 5 омо A 6 Oll DELL & 7 O * 8 O Save and Exit ( 9 ) O Next <☆ English 4 Submit Oct 7 Kinley Heath 40 LO X □: 2:04 0 D + = ( backspa1.) Which organism has the greatest amount of energy? 2.) Which has the least amount of energy? 3.) Which 3 animals are called first order consumers? 4.) Which 3 animals are called order & 2nd order consumers? 5.) What is the real source of energy in a food web or food chain?