While inspecting the genome sequence of your newly discoyered organism, you note that while the genome overall is 50% G + C, there is a cluster of genes comprising about 20,000 bp that is 64% G+ C. The best explanation for this is Multiple Choice the 20,000 bp segment is a recent acquisition via horizontal gene transfer the 20,000 bp segment likely contains a cluster of housekeeping genes this represents normal variation within a chromosome the 20,000 bp segment is an adaptation to a more thermophilic environment

While inspecting the genome sequence of your newly discoyered organism, you note that while the genome overall is 50% G + C, there is a cluster of genes comprising about 20,000 bp that is 64% G+ C. The best explanation for this is Multiple Choice the 20,000 bp segment is a recent acquisition via horizontal gene transfer the 20,000 bp segment likely contains a cluster of housekeeping genes this represents normal variation within a chromosome the 20,000 bp segment is an adaptation to a more thermophilic environment

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 3QP: A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13....

See similar textbooks

Related questions

Q: In several experiments, you find these orders of genes getting transferred in from the chromosome…

A: F plasmid is a type of plasmid which allows the transfer of genes from one bacteria to the other…

Q: Explain the role of boundary elements in the DNA. If you were to use gene editing technology to…

A: Detailed explanation: Let's break down the role of boundary elements in DNA and explore the…

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: A research team interested in mapping human genes discovered a new restriction length polymorphism…

A: Restriction fragment length polymorphisms (RFLPs) uses the variations in DNA sequences of genome…

Q: You would like to amplify the gene shown here using PCR. Assume the primer to the 5' end of the…

A: PCR stands for Polymerase Chain Reaction. This is used to amplify the gene of interest.

Q: 1) polymerize chain reaction is an experimental method for making multiple copies of segments of DNA…

A: Questions : 1) polymerize chain reaction is an experimental method for making multiple copies of…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

A: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the…

A: There are a lot of mobile DNA components in the genomes of mammals, including humans. These…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all…

A: Note that in determining the complementary of a DNA sequence, always remember that adenine (A) pairs…

Q: A technique called fluorescence in situ hybridization (FISH) is described. In this method, a labeled…

A: FISH (Fluorescence in situ hybridization) is the molecular cytogenetic of hybridization, in which a…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

While inspecting the genome sequence of your newly discoyered organism, you note that while the genome overall is 50% G + C, there is a cluster of
genes comprising about 20,000 bp that is 64% G+ C. The best explanation for this is
Multiple Choice
the 20,000 bp segment is a recent acquisition via horizontal gene transfer
the 20,000 bp segment likely contains a cluster of housekeeping genes
this represents normal variation within a chromosome
the 20,000 bp segment is an adaptation to a more thermophilic environment

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?
The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
The best estimate is that the human genome containsfewer than 21,000 genes. However, there is evidencethat human cells produce many more than 21,000 different polypeptides. What processes might account for thisdiscrepancy?
Look at the two yeast colonies in Figure Q4–3. Eachof these colonies contains about 100,000 cells descendedfrom a single yeast cell, originally somewhere in the mid-dle of the clump. A white colony arises when the Ade2 geneis expressed from its normal chromosomal location. Whenthe Ade2 gene is moved to a location near a telomere, itis packed into heterochromatin and inactivated in mostcells, giving rise to colonies that are mostly red. In theselargely red colonies, white sectors fan out from the middleof the colony. In both the red and white sectors, the Ade2 gene is still located near telomeres. Explain why white sec-tors have formed near the rim of the red colony. Based onthe patterns observed, what can you conclude about thepropagation of the transcriptional state of the Ade2 genefrom mother to daughter cells in this experiment?
Drosophila researchers have collected many strainsthat carry a single recombinant P element containing awild-type white gene (a P[w+] transgene) inserted intoa known genomic location. These strains can be used tomap the location of any mutant gene in the fly genome.Investigators performed a testcross to map arecessive mutation rough (ro), which causes rougheyes, relative to a P[w+] element on chromosome 3.Females heterozygous for the P[w+] on one chromosome 3 and a ro− mutation on the other, homologouschromosome 3 were crossed to ro−/ro− males, and theprogeny in the following list were obtained. In boththe parents and the progeny, the endogenous whitegene is nonfunctional—the flies have red eyes onlyif they contain the P[w+] transgene.145 red, smooth (wild-type) eyes152 white, rough eyes2 white, smooth eyes1 red, rough eyesa. Are ro and the P[w+] linked? If so, how many mapunits separate them?b. The data in part (a) do not indicate on which sideof the P[w+] (toward the centromere or…
Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the table:Draw a map that shows the order of genes and the locations ofthe origins of transfer among these different Hfr strains?
As shown, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated.
Please atleast answer this question
If you expose human tissue culture cells (for example,HeLa cells) to 3H-thymidine just as they enter Sphase, then wash this material off the cells and letthem go through a second S phase before looking atthe chromosomes, how would you expect the 3H to bedistributed over a pair of homologous chromosomes?(Ignore the effect recombination could have on thisoutcome.) Would the radioactivity be in (a) one chromatid of one homolog, (b) both chromatids of one homolog, (c) one chromatid each of both homologs,(d) both chromatids of both homologs, or (e) someother pattern? Choose the correct answer and explainyour reasoning. (This problem extends the analysisbegun in Solved Problem III.)
You know from your calculationsthat only a small proportion of the human genome is represented, even when the entire class results areconsidered. Therefore, the chance of finding a particular single-copy gene in your library is very small.Outline a strategy for constructing a genomic DNA library more representative of the entire humangenome. You will need to consider alternative vectors and the efficiency of transformation of thebacterial cells.