Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid residue? Gln-X-Ser O His-X-Ser O Arg-X-Ser O Asn-X-Ser O Asp-X-Ser
Q: Which of the following represents an example of a proteoglycan? attachment of several molecules of…
A: Proteoglycans can be defined as the heavily glycosylated proteins (high molecular weight) found in…
Q: Which of the following is not a polypeptide posttranslational modification? O Phosphorylation O…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: sample a peptide of known sequence was treated with trypsin; another sample of the same peptide was…
A: Protein sequence analyses are experimental methods that determine the amino acid sequence of a…
Q: Which of the following amino acids is not formed after post-translational modification? A.…
A: Post translational modification is the covalent modification of protein after Protein synthesis.…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: Pyridoxal phosphate (PLP) has the main function of converting one type of amino acid to another…
A: Cofactors are molecules which are needed by enzymes to complete thier activities . Without them…
Q: Which of these is a post-translational modification that targets a protein to the proteasome? LO…
A: Post-translational modifications include changes in the polypeptide chain after its synthesis during…
Q: Cyanogen bromide cleavage of a peptide results in 3 fragments with the sequence: AGRFM, RS, and…
A: Cyanogen bromide (CNBr), is an inorganic pseudohalogen, which helps in modifying peptides and…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…
Q: Which amino acid is predominantly used to add an NH2 moiety during the de novo biosynthesis of…
A: Denovo synthesis of Nucleotides referes to the process of Synthesis of nucleotides from simple…
Q: Which of the following is not a helix destabilizer? O Adjacent amino acid residues with big,…
A: A helix is a protein secondary structure that is defined as the regular arrangement of nearby…
Q: A В Asparagine D. Methionine A AG E G F
A:
Q: What amino acid residue of phosphoglucomutase is able to transfer the phosphoryl group to glucose…
A: The glycogen’s phosphorolytic cleavage produce the glucose-1- phosphate and to enter the metabolism…
Q: Which of the following amino acids is coded for by the above tRNA molecule (in a typical…
A: A tRNA atom has a "L" structure held together by hydrogen connections between bases in various…
Q: Consider the hypothetical serine protease, which shows the specificity pockets. The S, pocket has a…
A: Serine proteases are a family of enzymes that are capable of cleaving peptide linkage of proteins.…
Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA
A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…
Q: A portion of an unknown enzyme has the amino acid sequence serine phenylalanine - glutamate -…
A: Gene is the sequence of nucleotides that encode a specific protein.
Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…
A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…
Q: A mutation that changes an alanine to a leucine in the nucleus of a protein leads to a less active…
A: Introduction: Each organism's DNA sequence is unique. Its base-pairs sequence can change from time…
Q: In protein biosynthesis, the first codon of the new amino acid chain corresponds to: a. C…
A: The codons are triplets of nucleotides present in the mRNA sequence. There is a total of 64…
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…
A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…
Q: Which of the following statements about protein elongation are correct? I. There is a nucleophilic…
A: Replication, transcription and translation are basic mechanisms performed by genetic material along…
Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S,…
A: Proteases: These are enzymes that cleave peptide bonds of an amino acid chain of the protein. In…
Q: A. Predict the fragments that will be generated from the treatment of the following peptide with:…
A: Proteases are enzymes that bring about the cleavage of proteins into oligopeptides or individual…
Q: Synthesis of peptide bonds is [exorgonic or endergonic]. Thus in isolation, this reaction would…
A: Protein synthesis takes place in the ribosome. It required the hydrolysis of GTP. The translation is…
Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…
A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…
Q: Adenylylation is a post-translational modification that can regulate the Adenylyation involves the…
A: Introduction: In living organisms, hundreds of different enzyme-catalyzed reactions occur…
Q: Which of the following statements regarding O-linked glycosylation is FALSE? A. It occurs on…
A: O linked glycosylation is the attachment of a sugar molecule to the oxygen atom of serine or…
Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…
A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…
Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No
A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…
Q: Pol II is active when its tail is phosphorylated. Which of the following amino acids is present in…
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The following sequence is a portion of the N-terminus of the ACE2 receptor. The secondary structure…
A: Each amino acid has a different property.
Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S1…
A: Protease: It is an enzyme that speeds up or catalyzes the process of proteolysis, which reduces…
Q: Which of the following amino acid sequences would yield the most optimal oligonucleotide probe?…
A: In molecular biology, the amino acid sequence is defined as the protein or peptide with a linear…
Q: Post-translational modifications of proteins may include which of the following processes? Hint:…
A: Please follow steps 2 & 3 for a detailed explanation of both questions.
Q: A peptide with the sequence AELQAKSAIAHELQAKAAIAHA is treated with ATP while in the presence of…
A: Amino acid sequence (primary structure) folds on itself to form secondary structures such as…
Q: Which of the following is NOT true about polypeptides? The peptide bond that links the amino acids…
A: Polypeptide chains are made up of amino acid, these polypeptide chains are folded into primary,…
Q: Which statement is true for the active site residues of RNase A, lysozyme, or trypsin? Select…
A: Introduction: Those molecules that increase the pace of the reaction without undergoing any change…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: Which of the following statements about bacterial translation is FALSE? O A. The arrangement of key…
A: A) The ribosomes have the two subunits of the rRNA and the proteins, a large subunit with the three…
Q: What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU…
A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…
Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: The biosynthetic pathway for the two amino acides E and H is shown schematically in the Figure…
A: Feedback inhibition is a cellular control mechanism in which an enzyme's activity is inhibited by…
Q: Which of the following statements is true?a) Exonuclease III removes nucleotide residues from the 3’…
A: b) Bacteriophage lambda exonuclease removes terminal phosphates - Bacteriophage lambda exonuclease…
Q: Posttranslational modifications of proteins do not include: peptide bond formation glycosylation…
A: Proteins are one of the essential biomolecules for life. These are formed by translation from the…
Q: Define the following terms:a. decoding centerb. peptidyl transferase centerc. GTPase-associated…
A: Nucleic acid can be defined as the molecule which carries the information of the cell and that…
Q: Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: Proteins are the building blocks of the body. Proteins are made up of amino acids. All the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopThere are around 20 different versions of this molecule, which create different proteins when linked up in different sequences (like different letters making different words). What is one of these linked molecules named? * GLN ASP MET LEU MET SER LYS ASP GLU HIS THR LEU ILE LEU TRP LYS GLY GLN PRO PRO THR GLY: Glycine TRP: Tryptophan HIS: Histidine MET: Methionine THR: Threonine ASP: Aspartic acid LYS: Lysine ILE: Isoleucine LEU: Leucine GLU: Glutamic acid ALA: Alanine PRO: Proline SER: Serine GLN: Glutamine O Carbohydrate O Amino Acid O Nucleotide O Lipid
- Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В сA sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Ala Ser Glu-Met-AspLys Cys-His Ile His-Arg Thr-Trp Ala Ile-Phe-Asn-Arg Trp Cys–Cys–Gln The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Glu-Met-Asp Lys-Trp Asn-ArgAla Ser Cys-His-Ile-His-Arg-Thr-Trp Ala Ile-Phe Cys-Cys-Gin The original peptide sequence was:You have digested a small protein with two different proteases, each protease acting on the protein in separate reactions. These are the peptide fragments generated: Trypsin: IPVK: Ile-Pro-Val-Lys ALEL: Ala-Leu-Glu-Leu HRPGDR: His-Arg-Pro-Gly-Asp-Arg FGADAEDGAMNK: Phe-Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys YLEFISECIIQVLQSK: Tyr-Leu-Glu-Phe-Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys Chymotrypsin: (Reaction conditions were used to maximize cutting to the C-terminal size of F, W, and Y.) LEF: Leu-Glu-Phe IPVKY: Ile-Pro-Val-Lys-Tyr GADAEDGAMNKALEL: Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-Leu ISECIIQVLQSKHRPGDRF: Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys-His-Arg-Pro-Gly-Asp-Arg-Phe I am not sure what these questions are asking.
- Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1, AA2, and AA3 so that the parallel B-sheet is amphipathic and remains stable. Glu-lle-Asn-AA1-Cys-Val Ser-AA2-GIn-Leu-Lys-Phe Lys-Met-Cys-Leu-AA3-Val O AA1 = Pro, AA2 = Leu, AA3 = lle O AA1 = Val, AA2 = Leu, AA3 = Asn O AA1 = Ala, AA2 = Gly, AA3 = Leu AA1 = Phe, AA2 = Arg, AA3 = Ala O OA polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Subjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P O A. Lys and Met-Phe-Val-Trp-Glu-Gln-Arg and Pro-Ser-Pro OB, Leu-Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gln-Arg-Pro-Ser-Pro OC. Op. Lys and Met-Phe-Val-Trp-Glu-Gln-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro OE.Pro-CHEMBIO peptide is a large peptide sequence with three disulfide bonds (indicated by the lines between cysteine residues). CHEMBIO Protease cleaves amide bonds between two basic amino acid residues to give the final peptide that is active in the body. The products of this protease reaction are: 1. Two chains that make up active CHEMBIO peptide, which contain the N- and C-terminus sections of the original Pro-CHEMBIO molecule 2. A separate inactive peptide What if instead of CHEMBIO Protease, this peptide was cleaved by trypsin? Indicate the cleavage locations on the structure below. asap