Which of the following isnot a characteristic of aimmunesecondaryresponse?IgG isotypeNo lag phasesLow-affinity antibodiesHigh-affinity antibodiesNext

This is the subsequent immune response after the primary immune response, also known as the…

Answered: Which of the following not a…

Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag phases ○ Low-affinity antibodies O High-affinity antibodies. Next

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter45: Defenses Against Disease

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Related questions

Q: The comea is covers the iris and pupil .A True .B False

A: Cornea is outer, clear, round, structure. Cornea directs light rays into the eyes.

Q: Consider the cross RrmmTT x RRMmTt. Assume the three gene pairs are independently segregating. a.…

A: Introduction The alleles of two (or more) distinct genes are sorted into gametes independently of…

Q: Over time, enough genetic variations can develop within a population to cause it to undergo…

A: According to the biological species concept, organisms belong to the same species if they can…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: Why does the hydrolysis of ATP release so much energy? Because very strong bonds are required…

A: The mechanism of ATP hydrolysis is an exergonic one. It generates adenosine diphosphate (ADP),…

Q: Fats are solids at room temperature and contain saturated fatty acids while ______ are liquids at…

A: Fats are the long chain molecules of esters made up of two sections, a glycerol part joined to a…

Q: What type of features do you feel should be used to classify humans as a species? please answer…

A: Modern taxonomic classification system has 8 main levels. Domain Kingdom Phylum…

Q: Research how the concepts and techniques in molecular biology are applied in disease diagnosis and…

A: The concept and techniques of molecular biology involves genetic engineering which means the…

Q: Lab Data Tube 1 White Light Volume (ml) 3.3 4.5 5.7 6.8 8.2 сл Time (min) Tube 2 Covered Volume (mL)…

A: Rate of volume change = final volume - initial volume/time × 60 Rate of volume change for tube 1…

Q: Answer the following about low carbohydrate diets: true/false Is made up of a large about of nonfat…

A: 1) A low carbohydrate diet is the one which includes the food items that contains a low amount of…

Q: What are the basic components of a Fluorescence Microscope and what are the functions of each? Are…

A: Microscopes are laboratory instruments that are used to view and study things that cannot be seen…

Q: Which of the following receptor types will trigger the release of cytokines in macrophages? O A.…

A: INTRODUCTION Cytokines They are chemokines, interferons, interleukins, lymphokines and tumor…

Q: Who originally deserved Kudos for genetic engineering

A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…

Q: In a mutant mouse, it was discovered that a gene "W" is moved from its original chromosomal locus to…

A: Answer- Option C -reduced in the mutant mouse than in the wild-type mouse.

Q: Charles Darwin came up with several original ideas in his 1859 publication The Origin of Species.…

A: Charles Darwin propounded his fmous theory of natural selection which explains the process of…

Q: Neoplastic cells typically evade immunosurveillance. Explain how this occurs and describe how…

A: Neoplastic tells are the cancer cells which are created by the uncontrol division of a specific…

Q: Which of the following statements best describes the inheritance pattern of an X-linked dominant…

A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…

Q: 43. The medical staff at an isolated public health clinic in rural Peru decide to administer oral…

A: Introduction An outbreak occurs when the number of cases of a disease exceeds the normal…

Q: 29. A 31-year-old primigravid woman at 33 weeks' gestation is brought to the emergency department…

A: Introduction :- The cavernous sinus is a portion of the dural venous sinus in the brain, and it…

Q: Evolution of Whales This is an example of how microevolutionary changes eventually result in the…

A: Evolution is the process of gradual changes in the existing species, forming new traits and finally…

Q: Which macromolecule is made from aldehydes and ketones containing numerous hydroxyl groups and are…

A: Answer :- Correct option is A) Carbohydrates Carbohydrates, additionally called sugars, area unit…

Q: Which of the following bacteria can survive in in temperatures ranging from 390F (40C)---to 990F…

A: Thermophiles Are a type of heat-loving microbe that lives in a variety of ecological niches such as…

Q: Suggest how the weak points of the Molisch test for carbohydrates can be strengthened by comparing…

A: Introduction Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…

Q: C3bBb is the soluble C3 convertase that initiates the alternative pathway, while iC3bBb is the C3…

A: The answer is false.…

Q: 34, 32 33- 35 31- 30 36, 29 39 38 37 40, 28 27 26 25 42 24 23 44 45 46 2 -w 20 19 17 18 9 16 14 15…

A: Only the causal half of the embryo must twist 90 degrees after 72 hours of fertilisation, causing…

Q: To describe the life cycle of the typical basidiomycetes.

A: Basidiomycetes can be both beneficial and dangerous. Their attacks on foods and ornamental plants…

Q: biology professor at a prestigious university stated to his introductory class that “Today, a basic…

Q: Why is Indole more likely to travel through the cell membrane than tryptophan? The image here shows…

A: Any molecule can transfer across a protein free lipid bilayer over a variable period of time due to…

Q: 34°C Lab Data Tube 1 Green Light 3.3 3.5 3.7 3.8 4 Rate of volume change(- Time (min) 0 5 10 15 20…

A: Rate of photosynthesis for the green light: ROP = Rate of vol. change(Light) - Rate of vol.…

Q: where the three pl... 1 2 3 5 6 88 7 38 9 number of the structure affected by increased levels of…

A: Gland is a structure and is just like an organ but is involved of secretion of materials . Glands…

Q: What are rabi crop and kharif crop

A: Agriculture is the most important part of the lifestyle. The crop production occurs according to the…

Q: Q 5 - Another script was based on scenario 1. With an HIV prevalence of 0.1%. If an asymptomatic…

A: HIV prevelance 0.1% 68 year old man HIV positive

Q: Compare structures and cellular processes of chloroplasts with the structures and cellular processes…

A: Mitochrondria and chloroplast are cell organelle. Mitochondria is a double membrane bound…

Q: So how and why did Charles Darwin come to develop his ground-breaking Theory of Evolution?

Q: To describe how fungi affect the agriculture.

A: Microscopic creatures are referred to as microorganisms. Bacteria, archaea, protozoa, algae, fungi,…

Q: What hormone regulates the short term system related to hunger and satiety? Select one: O a. Insulin…

A: Introduction: Hormones are slow-acting chemical messengers produced by the endocrine system and…

Q: We will see an MI pattern when: There is crossover between two centromeres There is crossing over…

A: Haploid organisms such as Neurospora and other fungi are helpful in the detection of linkage and…

Q: The reason that why mycorrhizae might have been important in the colonization of terrestrial…

A: Mycorrhizae is a gerenally define that they are been symbiotic relationship between fungi and plant…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Compare and contrast stabilizing, directional and disruptive selection with regard to how each…

A: Introduction Natural selection is the adaptation and modification of populations of living…

Q: Explain why genetic disorders caused by recessive alleles of X-linked genes appear more frequently…

A: In humans and other mammals, biological sex is determined by a pair of sex chromosomes: XY in males…

Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…

A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…

Q: Why is variation in heritable traits essential to the evolution of a population

A: Genetic variation is a significant evolution force as it permits natural selection to increment or…

Q: Energy is required to do work. What type of work is being done by the Na+/K+ ATPase that allows it…

A: Na+/K+ ATPase is the protein responsible for the transport of sodium and potassium ions across the…

Q: Darwin and the Theory of Evolution - V2 So how and why did Charles Darwin come to develop his…

A: The theory of evolution is founded on the assumption that all species are connected and evolve over…

Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?

A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…

Q: According to current theories, people addicted to drugs still continue to use them because the…

A: the answer is false.…

Q: 1. Solve the given hardy-Weinberg principle. A population has a total number of 5222 and with…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: 4. Describe the pathogenesis of patient's disorders in the pigment exchange. 5. What changes in…

A: Hepatitis happens when your liver becomes inflamed, often due to a viral infection. Alcohol…

Q: Charcot-Marie-Tooth disease (CMT) is a heritable condition characterized by weakness in leg, foot,…

A: Answer-- The myelin in the motor neurons is damaged thereby preventing an impulse from moving along…

Concept explainers

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.

Question

Which of the following is
not a characteristic of a
immune
secondary
response?
IgG isotype
No lag phases
Low-affinity antibodies
High-affinity antibodies
Next

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1p

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What are the different properties of an antigenEnumerate and discuss the concept of antigenicityIdentify and differentiate the different types of antigenWhat are the different properties of an antibodyDifferentiate the various types of antibodies
Labs that do a lot of Western blots often have hundreds of primary bodies but only two or three secondary antibodies. Why? I understand that secondary antibody aids in the detection, sorting or purification of target antigens by binding to the primary antibody which directly binds to the target antigen. However, I don't undrstand why there are only two or three secondary antibodies available in the laboratory. Glad if the expert would advise.
Based on the constant region of the antibodies there are only five iso-types of the antibodies, while millions of different “V” region domains in the variable part of the antibodies.
I understand what autoantibodies are, but are ANAs the same thing as autoantibodies, or is there a difference between them. anti-nuclear antibodies (ANAs)
eds Antibodies (Immunoglobulins) Objective 14 Antibodies (immunoglobulins) are glycoproteins secreted by plasma cells. They are located in interstitial fluid, plasma (gamma globulin fraction) and in body secretions. onse A. Antibody Structure Heavy chain Antigen-binding site Light chain Insmakamos Hinge region Complement- binding site Stem region Macrophage binding site OHO (a) Antibody molecule OHO X = Disulfide bond Carbohydrate four polypeptide chains (two heavy, two light) chains are held together by covalent disulfide bonds (S=S) each heavy chain and each light chain has two functional areas: consists of highly variable amino acid sequences which forms the basis of antibody specificity; antigen binds here ????? to more conserved amino acid sequences; there are five basic sequences of amino acids, which define the 5 antibody classes (IgG, IgA, IgM, IgE and IgD); ????? each class has its own characteristic set of effector functions (see next page) Your notes: 4 40 4. 39
How are antibodies unique? Please discuss the structure of an antibody. What are the V and C regions? Discuss how the few hundred genes involved are capable of making endless amounts of antibodies. Besides medical treatment what is another way antibodies can be used?
Antibodies dont kill any pathogen directly, why is that?
Identify the highlighted part of the antibody O Antigen Binding Site O Constant region O Constant region of a heavy chain O Constant region of a light chain O Disulfide bond O Heavy chain O Light Chain O Variable region O Variable region of a heavy chain O Variable region of a light chain
Examine Type IV hypersensitivities by completing each sentence. 54 Туре IV МНС I tuberculin Compared to Type III hypersensitivities, reactions primarily involve -cell activity. T allografts Type IV dysfunction is known as secondary antigen exposure. hypersensitivity for symptoms arise 1 to several days following contact dermatitis delayed One example, infectious allergy, occurs during the reaction in persons sensitized by tuberculosis Lysosome infection. xenografts GVHD which occurs after exposure to antigens in The most common delayed allergic reaction, however, is plant resins, drugs, or personal articles, and involves the production of inflammatory cytokines that cause blistering. Autografts В -mediated reactions, while Finally, host rejection of grafted tissue can occur due to occurs when passenger cells in the grafted tissue attack host cells. MHC II Psoriasis
Basic Antibody Structure Label... Light Chain Heavy Chain Antigen Binding Site Disulfide Bonds DRAG 14 O Teamwork Toolbox
There are five major classes of antibodies. Complete the two below.
There are five major classes of antibodies. Complete the three below.