Q: Which of the following may be found in both a genomic and CDNA library? intron sequence promoter…
A: A genomic library contains DNA fragments that represents the complete genome of an organism. On the…
Q: Which of the following is true for translation or protein synthesis in this cell? Select all that…
A: The translation is the process of synthesis of the polypeptide chain that can be taken place in…
Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…
A: The translation process completes in three main steps. they are initiation, elongation, and…
Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…
Q: Which of the following is not directly involved in translation?
A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…
Q: Which of the following is false regarding mRNA processing? O The poly A tail that is found on the 3'…
A: mRNA processing mainly involves 3 steps- splicing addition of 5'end cap and 3'end polytail A…
Q: The genetic code is said to be "degenerate" because: There are more amino acids than codons.…
A: Genetic code refers to the triplets of nucleotides. The genetic information of mRNA is read in the…
Q: A type of RNA that has a “clover-leaf shape” with three hairpin loops. A.hnRNA B.rRNA C.mRNA…
A: RNA or Ribonucleic acid is a polynucleotide composed of ribonucleotides. These are formed from DNA…
Q: All of the following participate in the process of translation except: ribosomes mRNA tRNA 35S…
A: Translation It is defined as the process of production of proteins from the mRNA transcript. In…
Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…
A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…
Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…
A: Translation of genetic code into polypeptide chain is called translation.
Q: What is the difference between transcription and translation? Transcription is the conversion from…
A: The genetic material is stored in the DNA of the nucleus of the cell.
Q: Which of the following is NOT a correct pairing of the RNA type and its job O A. TRNA - in…
A: Introduction:- RNA (ribonucleic acid), complex compound of high molecular weight that functions in…
Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…
A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…
Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…
A:
Q: which of the following is mismatched a- small RNA catalyic with or without proteins b- rRNA 80% of…
A: RNA is coded from DNA with the help of RNA polymerase enzyme; the process of RNA synthesis is called…
Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon,…
A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…
Q: Which of the following processes occurs in the nucleus and forms acomplementary copy of one strand…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following is true of transcription and translation in prokaryotes and eukaryotes? A. In…
A: Transcription is the process of formation if m RNA from the DNA. Translation is the process of…
Q: Which of these pieces of a gene will ultimately be read by the ribosome to produce a protein?…
A: Pieces of genes introns and exons are actually nucleotide sequence within a gene. There is an…
Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…
A: BASIC INFORMATION TRANSCRIPTION it is responsible for the formation of hnRNA which has the codes…
Q: . Which of the following is not a function of RNA polymerase Il? A. Synthesis of MRNA B. Synthesis…
A: RNA polymerase is an enzyme that synthesise RNA from DNA template, therefore it is known as DNA…
Q: A portion of an mRNA molecule that determines one amino acid in apolypeptide chain is called a(n)a.…
A: Protein is synthesized from mRNA. Proteins are polymer of amino acid. 20 different amino acids are…
Q: Prokaryotic gene regulation occurs at the level of ________. a. translation b. transcription…
A: Prokaryotes are unicellular organisms and don't have a defined nucleus and their genetic material…
Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…
A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…
Q: Transcription and translation are separate processes in gene expression; however, they have…
A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…
Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…
A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…
Q: Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O…
A: The correct option is Removal of Introns. Explanation: Before it can be translated, eukaryotic…
Q: Which of the following RNAs is the product of transcription? mRNA only rRNA only mRNA, tRNA…
A: Introduction The process of transcribing a piece of DNA into RNA is known as transcription.…
Q: A promoter: is a small stretch of DNA that binds to proteins that initiate transcription is a small…
A: A promoter is a small stretch of DNA that binds to proteins that initiate transcription.
Q: The reading frame of a protein is determined by the first nucleotides in the mature mRNA sequence.…
A: The translation process is the protein synthesis process within a cell. mRNA coding is translated…
Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…
A: There are total of 64 codons coding for Amino acids.
Q: The ribosome recognizes and binds to the promoter region of DNA to initiate translation. true or…
A: To initiate translation a ribosome , an mRNA and an "initiator" tRNA carrying the first amino acid…
Q: Which of the following statements is true of eukaryotic transcription? Exons are spliced out from…
A: Introduction A genome is consisting of transcriptionally active genes. These genes form RNA…
Q: MRNE * Once the MRNA gets to the ribosome, it tries to fell the ribosome the message, but it doesn't…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Messenger RNA (MRNA) can be best described as: * A Chromosome that is only present in prokaryotes…
A: Messenger RNA or mRNA are single stranded RNA molecules that carries genetic information from the…
Q: Cells can control or regulate the amount of a particular proteins that is produced by using small…
A: RNAi (ribonucleic acid interference) is also known as gene silencing. It is a biological process…
Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…
A: Codon are the triple of a base pair.
Q: When proteins are being built, RNA bases are read in sets of three. What are these sets called?…
A: Proteins are synthesized through the process called translation. The information stored in the DNA…
Q: Which of the following forms of RNA are NOT found in prokaryotes? Question 8 options: snRNA rRNA…
A: Prokaryotes are the primitive cells that lack membrane bound cell organelles. Nucleus is not…
Q: In a ribosome, a maximum of TRNA molecules can be bound to the MRNA at any one time. O1 3 64
A: During translation, tRNA molecules first bind to the amino acids that correspond to their binding…
Q: Which of the following molecule functions in the SAME compartment in which it is synthesized? A.…
A: Except for a few proteins that are synthesised on mitochondrial and plastid ribosomes, all proteins…
Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…
A: Genetic code contains information that can be used by certain organelles to translate information…
Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…
A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…
Q: Each one gives some basic information and summarizes its main role in translation. mRNA:…
A: The central dogma was proposed by Francis Crick. There are three major processes: replication,…
Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…
A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…
Q: Which of the following molecular structures contan codons? a protein B mRNA C. IRNA D. rRNA and C
A: The genetic material contains the genetic information. It passes the information from parents to…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…
A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Part A Which of the following processes is represented in the figure below? A 5' ÀÚGÚÚČĞĞŮ 3' AAG UGA UUC RF1 RF2 transcription initiation translation initiation translation elongation transcription elongation translation termination O O OA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
- Which enzyme is responsible for "charging" tRNAS with the correct amino acid? OAminoacyl-tRNA synthetase ATP synthase Ribosomes RNA polymerases O O OWhich of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
- Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' endhe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
- The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position A G UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop A UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu ССС pro his CAC CUC CGC arg CỦA ССА CAA CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asi se ACC thr ACA AUC ile AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GGC gly GGA GUC GCC ala GCA GAC val GUA GAA glu GAG GUG GCG GGG proline (pro) histidine (His) O arginine (Arg) alanine (Ala) glycine (Gly) Third position (3'-end) First position (5'-end)