Which is a one letter code for a genetically encoded amino acid? A. X B. J C. U D. Q E. Z F. B The rinosome doesnt A. Stabilize the transition state in protein synthesis B. Translate the mRNA codon to the correct amino acid C. Help transfer protons to facilitate the coupling of carboxylates to ammoniums D. Process mRNA, tRNA, and the growing protein chain Hydrogen bonding primarily holds

Which is a one letter code for a genetically encoded amino acid? A. X B. J C. U D. Q E. Z F. B The rinosome doesnt A. Stabilize the transition state in protein synthesis B. Translate the mRNA codon to the correct amino acid C. Help transfer protons to facilitate the coupling of carboxylates to ammoniums D. Process mRNA, tRNA, and the growing protein chain Hydrogen bonding primarily holds

Name: Give detailed Solution with explanation needed Which is a one letter c
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give detailed Solution with explanation needed Which is a one letter code for a genetically encodedamino acid?A. XB. JC. UD. QE. ZF. BThe rinosome doesntA. Stabilize the transition state in protein synthesisB. Translate the mRNA codon to the correct

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Que The role of tRNA is to serve as stable translational components of the ribosome. serve as an intermediate in the decoding of the DNA sequence of a gene. O act as transporters bringing amino acids to the site of protein synthesis. facilitate splicing of pre-messenger RNAS.
If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use the codon chart provided above) a. Met Ile Ser b. Cys His Ala c. Gly Ala Thr d. Tyr Trp Val
Write a possible mRNA sequence that codes for each peptide. a. Phe–Phe–Leu–Lys b. Val–Gly–Gln–Asp–Asn c. Arg–His–Ile–Ser
Choose the answer that has these events of protein synthesis in the proper sequence. (Note some steps may be missing) A peptide bond forms A small ribosomal subunit binds with the mRNA. The tRNA leaves the P site, and the ribosome translocates to the P site. The Methionine initiator-tRNA binds to the start codon. An incoming amino-acyl tRNA binds to the A site The large ribosomal subunit binds the small subunit Group of answer choices A 4, 1, 2, 5, 6, 3 B 2, 4, 6, 5, 1, 3 C 1, 3, 2, 4, 5, 6 D 4, 1, 3, 2, 5, 6 E 5, 4, 3, 2, 6, 1
The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in? Oan MRNA strand with the sequence TTCGACCCT Oan MRNA strand with the sequence UUCGACCCU a sequence of three amino acids linked by peptide bonds Oa carbohydrate in the form of a polysaccharide
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
If a gene is mutated, then it may consequently affect the expressed in the central dogma which then may lead to alter the production/function of other bio-molecules. Select one: a. lipids b. carbohydrate С. DNA Ca d. protein Do Is w Wha ( Previous page Next page https:// Jump to... What Mar 13. These m https://bic 2.2A: V MacBook Pro esc n m-wanry ur @ # $ % & 1 2 3 4 6 Q W E Y tab А S D F G caps lock
Nucleotides play a variety of roles in the cell. Give an example of a nucleotide that acts in each of the following roles or processes.a. Second messengerb. Phosphoryl-group transferc. Activation of carbohydratesd. Activation of acetyl groupse. Transfer of electronsf. DNA sequencingg. Chemotherapyh. Allosteric effector
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5'→ 3' direction of mRNA? O a. PAE ОБ.ЕРА OC. AEP O d. PEA O e. E AP Which of the following is TRUE regarding eukaryotic RNA processing? O a. Functional individual FRNA cannot be produced without splicing. O b. Splicing of the MRNA precursor is done in the cytoplasm, while modification of the ends is done in the nucleus. OC. An unprocessed mRNA precursor is translocated into the cytoplasm to be modified before the translation. O d. Splicing of the mRNA precursor is done in the nucleus, while modification of the ends is done in the cytoplasm. O e. Transcription yields primary transcript, which can by itself yield a functional protein. RNA self-splicing demonstrates the role of RNA as a(n): O a. spliceosome. O b. intron. O c. nucleophile. O d. exon. O e. catalyst.
The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.