Answered: What part of the E.coli RNA polymerase…

Name: What part of the E.coli RNA polymerase specifically binds to the -10 a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What part of the E.coli RNA polymerase specifically binds to the -10 and -35 region of an E.coli promoter?

Science

Biology

What part of the E.coli RNA polymerase specifically binds to the -10 and -35 region of an E.coli promoter?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…

A: Replication, transcription, and translation are used by all cells to keep track of their genetic…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…

A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…

Q: How far apart are transcription bubbles on E. coli genes that are being transcribed at a maximal…

A: The transcription bubble is an area of unpaired bases on one of the uncovered DNA strands. The…

Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…

A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…

Q: G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double…

A: The Mendelian gene is a basic unit of the heredity and the molecular gene is a sequence of…

Q: can cells tolerate errors made in transcription in comparison to errors made during DNA replication?

A: RNA polymerase lacks proofreading activity, so the probability of error is more than that of DNA…

Q: How does the RNA polymerase II enzyme identify/distinguish the “start” of a gene from the junk DNA…

A: Genes are DNA sequences that code for molecules, usually proteins, with specific functions. Each…

Q: Explain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.

A: Genetic code is considered degenerate, where several amino acids are encoded by more than just one…

Q: some eukaryotic mRNAs have internal ribosome binding sites, where ribosomes can bind without first…

A: Alternative splicing is a regulated process in which a single gene coding for multiple proteins…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

What part of the E.coli RNA polymerase specifically binds to the -10 and -35 region of an E.coli promoter?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribed
The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?
Answer these questions concerning promoters. a) What role do promoters play in transcription? b) What is the common structure of bacterial promoter with respect to consensus sequences? c) Eukaryotic promoters are more variable than bacterial promoters. Why? d) What is the meaning of the term alternative promoter? How does the use of alternative promoters affect transcription?
What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100- kDa protein?
What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?
One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?
Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To make the Hex A protein: The promoter and transcription termination sites are 33,000 base pairs apart. The Hex A protein has 600 amino acids 5’ and 3’ UTR’s are each 500 bp long. a)How many base pairs would you expect in the final mRNA? Show your work b)How many bases were spliced out? Show your work
How does the intrinsically disordered C-terminal domain of RNA polymerase II contribute to the regulation of transcription?
How long would it take for the E. coli RNA polymerase to synthesize the primary transcript for the E. coli genes encoding the enzymes for lactose metabolism, the 5,300 bp5,300 bp lac operon? Assume an average elongation rate of 7070 nucleotides per second. a)How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10 seconds10 seconds? b)Assuming that human Pol II transcribes at a similar rate, how long does it take to transcribe the 2,000,000 bp2,000,000 bp dystrophin gene?
some eukaryotic mRNAs have internal ribosome binding sites, where ribosomes can bind without first attaching to the 5′ cap. Yet all eukaryotic mRNAs are capped, and cap-dependent translation is highly efficient. What might be the advantage of having internal ribosome binding sites if the cap permits the initiation of translation and all eukaryotic mRNAs are capped?