Answered: What is the output of this code? def…

What is the output of this code? def main(): x = myfun(5) y = myfun(4) z = myfun(2) print(x + y + z) def myfun(p): ans = p*3 return ans main()

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Art.java In this part you will create a program Art.java that produces a recursive drawing of the…

A: Explanation : Note : For simplicity purpose I have drawn lines just 300 times You can change it…

Q: PROGRAMMING LANGUAGE: C++ Is it possible to overload the ‘+’ operator for data type int?

A: Given:- PROGRAMMING LANGUAGE: C++ Is it possible to overload the ‘+’ operator for data type…

Q: static void final0{ can access mark; (True / False) can access noOfAss; (True / False) can invoke…

A: Intially all are

Q: Editable source code: #include int isEven(int); int main(void) { // TODO: Write your code…

A: Introduction: Start by reading the value n. Repeat the loop for n times. Take a look at the number…

Q: rogramming: C# (Csharp) Help me please kindly apply the C# METHOD on my program Here is my code:…

A: Below is the required C sharp program. Program Approach: There are two types of methods, static…

Q: You need to store hiring date and date of birth for teachers, and for students store their admission…

A: Composition: Composition in C++- In real life, complex structures are often constructed from…

Q: In Python, grades_dict = {'Wally': [87,96,70], 'Eva': [100,87,90],…

A: Answer:

Q: 1- define a second argument (example "int number2 = 9") and a pointer to it 2- define a second…

A: The function accepts two integer references and adds the numbers present in both references and…

Q: Hangman Game in C++ The instructions are in the pictures. This is what it is supposed to look like:…

A: Note: As you have not uploaded the randword.h and randword.cpp file, I am taking the example of two…

Q: wish to further break it down into (i) a function that walks the grid in a direction you specify the…

A: Python code def make_unique(matrix, singleWord, x, y,numberOfRow, numberOfColumn, stire) : l =…

Q: void funOne(int a, int& b, char v); void main() { int num1=10; char ch='A'; funOne(num1,…

A: Invalid

Q: T1 read_item (X); read_item (Y); Y = Y +X write_item (Y); T2 read_item (X); read_item (Y); Z = Y - X…

A: Timestamp Ordering Protocol The Timestamp Ordering Protocol is used to order the transactions based…

Q: Code using c++ Instructions: In the code editor, you are provided with the definition of a struct…

A: #include <iostream>using namespace std; typedef struct { int age; char gender;} Person;…

Q: You are roaming in a random city and you have los to X and Y street if 1 <= Y - X <= K, where K is a…

A: I have written the Ruby code below:

Q: Ruby Programming: Write a function that takes a number x as a parameter and returns the value of…

A: Write a function that takes a number x as a parameter and returns the value of x2. Solution: Square…

Q: Using the following header, create a recursive function that shows an integer value backwards on the…

A: Recursion is a process by which a function calls itself repeatedly till it falls under the base…

Q: In C++, as an actual parameter, can an array be passed by value?

A: Actual parameter: Actual parameter is the actual value that is passed into the method by a caller.…

Q: Name: class Refint { int n; } class Driver ( static void g (RefInt r) { r.nr.n+ 1; r new Ref Int ();…

A: 14. (0 is the answer.)A is answer because last statement of the function is a.n=0 17. (0 is…

Q: Hangman Game in C++ The instructions are in the pictures. This is what it is supposed to look like:…

A: Note: As you have not uploaded the randword.h and randword.cpp file, I am taking the example of two…

Q: Describe Operations on Pointer Variables.

A: The pointer variable works with the memory location, all the data access, and stored directly into…

Q: Code Example: def get_volume (width, height, length=2): width * * height length volume return volume…

A: Functions in python: A function is a group of connected claims that together carry out a…

Q: JAVA CODE ONLY AND PROVIDE OUTPUT SCREENSHOT

A: I have provided JAVA CODE along with TWO OUTPUT SCREENSHOTS-----------------

Q: #include /* print Fahrenheit-Celsius table for fahr = 0, 20, ..., 300; floating-point version /…

A: Given: We need to update the code to use the for loop. The code is given below:

Q: using java The program has to evaluate arithmetic expressions using a BST for that purpose. The…

A: Lets see the solution in the next steps

Q: PROGRAMMING LANGUAGE: C++ SUBJECT: OOP Task: Find errors in the following code and rewrite a…

A: There are two errors in this program. I have provided an explanation of both with the correction…

Q: Instructions: In the code editor, you are provided with a treasureChestMagic() function which has…

A: In this question we have to write a program in which using C language where We need to write a main…

Q: uble* y3): For given three 2D points A(x1,y1), unter-clockwise and return them in the correct ath.h…

A: #include<stdio.h> #include<graphics.h> #include<math.h> int main() {…

Q: In this part you will create a program Art.java that produces a recursive drawing of the design…

A: For simplicity purpose I have drawn lines just 300 times You can change it accordingly. As the…

Q: main() { int a = 1, b = 2, c = 3: printf("%d", a + = (a + = 3, 5, a)) } Output…

A: Solution -: Given code is : main() { int a = 1, b = 2, c = 3: printf("%d", a + = (a + =…

Q: void exchangeByValue (int x, int y) { printf ("\n\nOriginal x and y received: $d $d", x, y); int…

Q: void main() int 2a-103; printf("%d",2a); ans. 10 2a 20 Compilation Error

A: Answer: The above code will generate compilation error because variable declaration is incorrect.…

Q: ubtractMe(x): k = x - (2/0) if (k <= 6): return 6

A: Lets see the solution.

Q: Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() }…

A: According the Question below the solution:

Q: Ruby Programming: You are roaming in a random city and you have lost. You see a sign board and where…

A: Introduction: As per the given problem statement, find the way using the street and develop Ruby…

Q: C++ Using the code provided below Do the Following: Modify the Insert Tool Function to ask the user…

A: I have given C++ Code without error, hope you like it.

Q: NOTE: The important method has been ATTRIBUTES given to you. userld:int //generates unique id from…

A: Constructor is the same name as class name and these are invoked when the object is created.…

Q: remove the error from program( C programming language)

A: #include<stdio.h>#include<string.h>#include<pthread.h>#include<stdlib.h>#inc…

Q: VALID or INVALID. 1. #define PI 3.1416; _2. if(n1='A') 3. Do 4. case(1) 5. N*=1; _6. clrscr(); _7.…

A: 1. #define PI 3.1416; is invalid because there should be no semicolon at the end. The correct…

Question

What is the output of this code?
def main():
x = myfun(5)
y = myfun(4)
z = myfun(2)
print(x +y + z)
def myfun(p):
ans = p * 3
return ans
main()

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

language c++
Please explain this question void main() {int a =300; char *ptr = (char*) &a ; ptr ++; *ptr =2; printf("%d", a); }
C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.
The function ver() is defined as follows: void ver(char "pc) { char c; if( "pc == "\O' ) return; c = "pc; ++pc; ver(pc); putchar(c); Show the output when function ver() is called as follows: ver("recursion");
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Computer Science Part C: Interactive Driver Program Write an interactive driver program that creates a Course object (you can decide the name and roster/waitlist sizes). Then, use a loop to interactively allow the user to add students, drop students, or view the course. Display the result (success/failure) of each add/drop.
What is the output of this code? def func(a,b): if(b==1): return a else: return a* func(a,b-1) A It adds a and b (B) None of these choices © It multiplies a and b (D) It raises a to the power of b
In Python, grades_dict = {'Wally': [87,96,70], 'Eva': [100,87,90], 'Sam': [94,77,90], 'Katie': [100,81,82], 'Bob': [83, 65, 85]} write your own describe function that produces thesame 8 statistical results, for each one of the columns, that the built-in describe() function does.Note 1: Use the sample standard deviation formula (that is, the denominator is: N-1)Note 2: Your algorithm should work for any number of columns not just for 5Note 3: You can use the np.percentile() for the 25% and 75% percentile as well as the sort()built-in functions
Integer userValue is read from input. Assume userValue is greater than 1000 and less than 99999. Assign tensDigit with userValue's tens place value. Ex: If the input is 15876, then the output is: The value in the tens place is: 7 2 3 public class ValueFinder { 4 5 6 7 8 9 10 11 12 13 GHE 14 15 16} public static void main(String[] args) { new Scanner(System.in); } Scanner scnr int userValue; int tensDigit; int tempVal; userValue = scnr.nextInt(); Your code goes here */ 11 System.out.println("The value in the tens place is: + tensDigit);
Compilation Techniques The program snippet is known as follows: a = 10; b = 1; c = 2; do { b = b + 1 while (b <= 10) { if (a%2==0) c = c + b; a = a + 1; } } while (c < = 30); Make a code generator for the above program fragment.