Answered: What is the function of DNA? 2. What…

Science

Biology

What is the function of DNA? 2. What two membranes protect the fragile DNA molecules from damage?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter4: Organization Of The Cell

Section: Chapter Questions

Problem 1TYU: Which of the following is the most fundamental feature that enables the cell to function as a...

See similar textbooks

Related questions

Q: 1. Make a diagram of DNA replication. 2. Discuss DNA to RNA transcription (ATLEAST 5 SENTENCES).

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: List seven enzymes and proteins needed in a DNA Replication. Briefly state their functions

A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…

Q: What are 3 ways that DNA transcription is different from DNA replication.

A: DNA replication occurs before a cell can divide. During DNA replication, DNA helicase unwinds the…

Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…

A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: summarize what happens in DNA Replication (focus on the enzymes necessary for each step)

A: DNA replication is semiconservative in nature in which parent strands are separated during…

Q: 1. What does DNA stand for? 1 2. What model represents

A: DNA, short for deoxyribonucleic acid, is the molecule that contains the genetic code of organisms.…

Q: 8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA…

A: As per our guideline, I gave you the first 3 answer below. Please post rest of the question…

Q: What is the nature of genetic mutation of DNA repair proteins?

A: DNA repair proteins are those that are involved in repair of damaged or mutated DNA. Mutations can…

Q: What is the correct order of the stages of DNA synthesis? A) Unwinding the DNA, synthesis of a…

A: The manufacture of deoxyribonucleic acid (DNA) molecules, whether natural or artificial, is known as…

Q: Distinguish DNA and RNA according to their structure and functions.

A: DNA & RNA are the nucleic acid found in living organism. DNA: Deoxyribonucleic acid RNA:…

Q: 3b) During DNA replication, one new DNA strand is synthesized continuously but the other strand is…

A: DNA is a long polymer of nucleotides which makes the genetic material of most of the living organism…

Q: The diagram shows the structure of DNA with complementary base pairing between strands. Bood 3' CG…

A: Double-stranded DNA has two strands of complementary DNA wherein Adenosine is bonded to Thymine via…

Q: 1. Where is protein produced in a cell? 2. What scientists discovered the structure of DNA? 3. What…

A: # According to our guideline we can answer only the first question or first 3 subparts of a…

Q: 4. DNA replication includes events 1 to 5. 1. Opposite strands are separated 2. Free DNA nucleotides…

A: Note: According to the guidelines, we are supposed to answer only 1st question. Please repost other…

Q: 1. Write out the full name for DNA. 2. What is a gene? 3. Where in the cell are chromosomes located?…

A: DNA is the basic genetic and hereditary material in most eukaryotic organisms. It is a nucleic acid.…

Q: What do DNA and proteins have to do with each other

A: DNA is deoxyribonucleic acid. DNA contains genetic information. Proteins are made up of amino…

Q: Describe the basic structure of a DNA? Give the different components of DNA and their function in…

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…

Q: . What is vitamin D? 2.) What is a gene?

A: Vitamin D is the group of fat soluble secosteroids responsible for increasing the insterstinal…

Q: Explain how is DNA replicated and repaired?

A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…

Q: 17.What is something you found interesting about the connection between mitosis and cancer? Explain…

A: 17) Mitosis is the important cell division that takes place in our body. Mitosis is responsible for…

Q: Define nucleic acids. Mention the types and parts of nucleic acids 2. What are the monomers that…

A: Nucleic acids are the most important biomolecules present in a living organism. These are bipolymers…

Q: Why does every cell in our body contain DNA?

A: DNA is deoxyribonucleic acid which acts as genetic material in all the organisms. It is located in…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Transcription Formation of RNA over DNA template is called transcription. Out of 2 strand of DNA…

Q: 1. What is the purpose of recombinant DNA technology?

A: Since you have posted multiple questions, we will do one question for you. If you need any specific…

Q: the

A: DNA-DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic…

Q: 4. Write a short paragraph on mutations and how they may alter protein synthesis and function.

A: Introduction :- A mutation is a change in the genetic material in biology. This refers to changes in…

Q: Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss

A: DNA is a double stranded molecule which are linked together by hydrogen bonds. DNA replication means…

Q: When DNA replicates, how is it able to “unwind” its double helix?

A: DNA is able to unwind it's double helix with the help of enzyme DNA Helicase.

Q: 2. What differentiates one DNA molecule from another? 3. How can you modify your DNA model to…

A: According to the rules of the Bartleby.com, only the first three questions will be answered in this.…

Q: 2. To manipulate cells and DNA, scientists use tools that are borrowed from nature, including: These…

A: DNA (deoxyribonucleic acid) is the basic hereditary unit of an organism. The DNA is composed of a…

Q: 12. Find out the name of some DNA repair diseases that are inherited and explain which enzymes are…

A: DNA repair mechanism: The genetic system of human is very crucial for the well being of life. Any…

Q: What are the 6 steps of DNA replication ?

A: DNA replication is the process in which DNA of the cell is copied using enzymes called as DNA…

Q: 3. A rare genetic condition causes dwarfism and immunodeficiencies. Which of the following is the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: 4. Compare DNA and RNA as to structure and components.

A: Biological molecules or the biomolecules, are the substances that are produced by cells and living…

Q: What are the functions of enzymes/proteins involved in DNA replication and the process of DNA…

A: Replication usuually starts at a specific point on a dna sequence known as the origin of…

Q: 1) Why can the genome be thought of as life's instruction manual? 2) What is the difference between…

A: DNA is genetic material in most of organisms which carries genetic information and transfer it into…

Q: What is DNA and what do it look like? 2. Does the DNA of human Body could fit in a plate? 3. Where…

A: In every animal, the genetic material is carried out by a chromosome or any other structure that…

Q: How are these outlines related to the big picture of mutations influencing the expresssion of…

A: Hello there. As you have posted a question with multiple subparts, I will be answering the first 3…

Q: How many genes are needed to sustain life? 2. Using a flow diagram, trace the history of the…

A: Introduction The genetic material in our cells is called DNA, or deoxyribonucleic acid. It…

Q: 1. What will happen if there is a mistake in DNA replication? 2. What will happen if there is a…

A: In molecular biology DNA replication is the process in which DNA makes a copy of itself during the…

Q: What is DNA replication? 2. What are the principles of DNA replication?

A: DNA replication DNA , deoxyribonucleic acid , is made up of three components , a deoxyribose sugar ,…

Q: 1. DNA is used to tell people apart. What aspects of DNA do you think make this possible? 2. What…

A: According to the questions, we have to provide the aspects of why DNA is used to tell people apart,…

Q: WHY DO WE NEED GENETIC ENGINEERING?

A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…

Q: 8. What is the function of polymerase? It adds nucleotides. It unwinds the original DNA strand. It…

Q: I learned that the base pairs for DNA are and and the base pair of RNA are and I learned that…

A: Introduction:- Under normal circumstances, the nitrogen-containing bases adenine (A) and thymine (T)…

Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…

A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…

Q: 3. At which step would a mutation lead directly to the formation of an altered gene? DNA is copied…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Concept explainers

Cancer Therapy

Question

1. What is the function of DNA?

2. What two membranes protect the fragile DNA molecules from damage?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1- Introduction

VIEW

Step 2- Explanation

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss its cycle?
1. What will happen if there is a mistake in DNA replication? 2. What will happen if there is a mistake in translation or protein synthesis?
1. Choose one among the three: DNA replication, transcription, and translation and then discuss its entire process.
1. Where is protein produced in a cell? 2. What scientists discovered the structure of DNA? 3. What is the structure of DNA? 4. What makes up a nucleotide? 5. What are the 4 Nitrogenous bases found in DNA? 6. What type of bond is between the base pairs in DNA? 7. After replication, how many strands are old and how many are new? 8. What enzyme unzips or separates the original DNA strands?
1.What is DNA replication? 2. What are the principles of DNA replication?
1. What is the purpose of protein synthesis?" 2. Compare the base pair of DNA to the base pair of RNA?
1. If a chromosome had 25% guanine, what percent thymine would it have and why? 2. Describe the steps of DNA replication, transcription and translation.
1. Distinguish DNA and RNA according to their structure and functions.
1. What's the role of DNA in protein synthesis? 2. What occurs during transcription and why is it important? 3. List two differences between DNA and RNA?
1. What are chromosomes and where are they located? 2. How many chromosome do humans have? How are chromosomes inherited? 3. What are the components of a nucleotide? Name the four types of nucleotides. 4. What type of bonds holds the two DNA strands together? 5. What is complementary base pairing? 6. How does the DNA between individuals differ? 7. Define DNA replication 8. What is the function of the enzyme helicase in DNA replication? (unwinds and unzips DNA) 9. What is the function of the enzyme DNA polymerase in DNA replication? 10. DNA replication is semiconservative. Explain what this means. 11. Which method do scientist utilize to make extra copies (amplification) of DNA? 12. Describe the PCR technique. Why do scientist add primers, DNA polymerase and nucleotides during PCR method? Explain the purpose of each.
5. Discuss the nucleus and explain its immense functions.
1. Types of DNA damage and their causes.