Answer this for me mate. Much appreciated. What can you assume about the relationship between the enslaved people and the sailors transporting them? SOURCE: The Interesting Narrative of the Life of Olaudah Equiano, Or Gustavus Vassa, the African (London, 1789).Soon after this the blacks who brought me onboard went off, and left me abandoned to despair. I now saw myself deprived of all chance of returning to my native country, or even the least glimpse of hopeof gaining the shore, which I now considered as friendly; and I even wished for my former slavery in preference to my present situation, which was filled with horrors of every kind, still heightened by myignorance of what l was to undergo. I was not long suffered to indulge my grief; I was soon put down under the decks, and there I received such a salutation in my nostrils as I had never experienced in mylife: so that, with the loathsomeness of the stench, and crying together, II became so:so sick and low that I was not able to eat, nor had I the least desire to taste any thing. I now wished for the last friend, death,to relieve me; but soon, to my grief, two of the white men offered me eatables; and, on my refusing to eat, one of them held me fast by the hands, and laid me across I think the windlass, and tied my feet,while the other flogged me severely. I had never experienced any thing of this kind before; and although, not being used to the water, I naturally feared that element the first time I saw it, yet nevertheless,could I have got over the nettings, I would have jumped over the side, but I could not; and, besides, the crew used to watch us very closely who were not chained down to the decks, lest we should leap intothe water: and I have seen some of these poor African prisoners most severely cut for attempting to do so, and hourly whipped for not eating. This indeed was often the case with myself.In a little time after, amongst the poor chained men, I found some of my own nation, which in a small degree gave ease to my mind. I inquired of these what was to be done with us; they gave me tounderstand we were to be carried to these white people's country to work for them. I then was a little revived, and thought, if it were no worse than working, my situation was not so desperate: but still Ifeared I should be put to death, the white people looked and acted, as I thought, in so savage a manner; for I had never seen among any people such instances of brutal cruelty; and this not only showntowards us blacks, but also to some of the whites themselves....I could not help expressing my fears and apprehensions to some of my countrymen: I asked them if these people had no country, but lived in this hollow place (the ship): they told me they did not, but camefrom a distant one. 'Then, said I, 'how comes it in all our country we never heard of them?' They told me because they lived so very far off. I then asked where were their women? had they any likethemselves? I was told they had: 'and why, said I, 'do we not see them?' they answered, because they were left behind. I asked how the vessel could go? they told me they could not tell; but that there werecloths put upon the masts by the help of the ropes I saw, and then the vessel went on; and the white men had some spell or magic they put in the water when they liked in order to stop the vessel. I wasexceedingly amazed at this account, and really thought they were spirits. I therefore wished much to be from amongst them, for I expected they would sacrifice me: but my wishes were vain; for we were soquartered that it was impossible for any of us to make our escape....

The given passage discusses the relationship of an enslaved African to those Caucasians who seem to…

Answered: What can you assume about the…

Social Science

Sociology

What can you assume about the relationship between the enslaved people and the sailors transporting them?

Social Psychology (10th Edition)

10th Edition

ISBN:9780134641287

Author:Elliot Aronson, Timothy D. Wilson, Robin M. Akert, Samuel R. Sommers

Publisher:Elliot Aronson, Timothy D. Wilson, Robin M. Akert, Samuel R. Sommers

Chapter1: Introducing Social Psychology

Section: Chapter Questions

Problem 1RQ1

See similar textbooks

Related questions

Q: summary paragraph describing lysozyme and what it does

A: Lysozyme is a important enzyme perform verious important role in body. Lysosome helps in the…

Q: 2. Hemoglobin mutants (Answers to this question won't be posted – discussed in Discussion.) A. For a…

A: In T-R equilibrium for a mutant, a shift towards the R state indicates an increase in oxygen…

Q: Read and record the volume of liquid. Meniscus 100 ml Read 90 volume at bottom of meniscus.…

A: In the given figure, we are shown liquid sample which is filled in graduated cylinder. We have to…

Q: Bernard Katz won a Nobel prize for studying SNARE proteins. O True O False

A: SNARE proteins mediate vesicle fusion, a process that's essential for neurotransmission. While both…

Q: Which of the following is/are true about the signal recognition particle (SRP). Choose all that…

A: SRP is defined as the signal Receptor Protein that is a ribonucleoprotein particle and helps in…

Q: The adrenal medulla is important to the sympathetic branch of the autonomic nervous system because…

A: the adrenal medulla is the grey core of the adrenal gland. it is made up of cells called chromaffin…

Q: Songbirds sing using a type of muscle fiber called super fast-twitch muscles. These super…

A: Muscle contraction and relaxation are regulated by the levels of calcium ions in the sarcoplasm…

Q: Which procedure is represented in the diagram?

A: The movement of water across a membrane is called as osmosis. Diffusion is the movement of molecules…

Q: A в с E D F

A: Understanding anatomical terminology is crucial for accurately describing the locations and…

Q: a neural impulse; a brief electrical charge that travels down the axon the junction between the end…

A: Here are the correct matches to all the definitions listed.

Q: Can you please answer this question and say the correct letter

A: This is the second phase of action potential, where the Ca2+ channels open and allowing the movement…

Q: how the drug affected brain cells at the cellular or molecular level

Q: 32 bit laptop comp.. E- H-

A: Glands in the body are basically of two types :- A ) Exocrine gland B ) Endocrine gland Exocrine…

Q: Given that CDKS are "kinases", how do they activate or inactivate other proteins? Why are cyclins…

A: Period between two mitotic division is called as the cell cycle. Cell cycle is the event taking…

Question

Answer this for me mate. Much appreciated.

What can you assume about the relationship between the enslaved people and the sailors transporting them?

SOURCE: The Interesting Narrative of the Life of Olaudah Equiano, Or Gustavus Vassa, the African (London, 1789).
Soon after this the blacks who brought me onboard went off, and left me abandoned to despair. I now saw myself deprived of all chance of returning to my native country, or even the least glimpse of hope
of gaining the shore, which I now considered as friendly; and I even wished for my former slavery in preference to my present situation, which was filled with horrors of every kind, still heightened by my
ignorance of what l was to undergo. I was not long suffered to indulge my grief; I was soon put down under the decks, and there I received such a salutation in my nostrils as I had never experienced in my
life: so that, with the loathsomeness of the stench, and crying together, I
I became so:
so sick and low that I was not able to eat, nor had I the least desire to taste any thing. I now wished for the last friend, death,
to relieve me; but soon, to my grief, two of the white men offered me eatables; and, on my refusing to eat, one of them held me fast by the hands, and laid me across I think the windlass, and tied my feet,
while the other flogged me severely. I had never experienced any thing of this kind before; and although, not being used to the water, I naturally feared that element the first time I saw it, yet nevertheless,
could I have got over the nettings, I would have jumped over the side, but I could not; and, besides, the crew used to watch us very closely who were not chained down to the decks, lest we should leap into
the water: and I have seen some of these poor African prisoners most severely cut for attempting to do so, and hourly whipped for not eating. This indeed was often the case with myself.
In a little time after, amongst the poor chained men, I found some of my own nation, which in a small degree gave ease to my mind. I inquired of these what was to be done with us; they gave me to
understand we were to be carried to these white people's country to work for them. I then was a little revived, and thought, if it were no worse than working, my situation was not so desperate: but still I
feared I should be put to death, the white people looked and acted, as I thought, in so savage a manner; for I had never seen among any people such instances of brutal cruelty; and this not only shown
towards us blacks, but also to some of the whites themselves....
I could not help expressing my fears and apprehensions to some of my countrymen: I asked them if these people had no country, but lived in this hollow place (the ship): they told me they did not, but came
from a distant one. 'Then, said I, 'how comes it in all our country we never heard of them?' They told me because they lived so very far off. I then asked where were their women? had they any like
themselves? I was told they had: 'and why, said I, 'do we not see them?' they answered, because they were left behind. I asked how the vessel could go? they told me they could not tell; but that there were
cloths put upon the masts by the help of the ropes I saw, and then the vessel went on; and the white men had some spell or magic they put in the water when they liked in order to stop the vessel. I was
exceedingly amazed at this account, and really thought they were spirits. I therefore wished much to be from amongst them, for I expected they would sacrifice me: but my wishes were vain; for we were so
quartered that it was impossible for any of us to make our escape....

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Please Help me fill out crossword puzzle so I can have a visual copy of what it looks like , just don’t answer but fill it out the sheet
tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter
Can you please answer this question and say the correct letter
Alert - why you giving me wrong answer. Now this is last warning, Don't try to replicate someone else's work or use an AI platform to generate an answer. If I see these things, I'll definitely downvote you and report you.
Hey ! Please help me please... It's so important for me... Please match only no detailed answer required