Second letter C UUU Phe UCU1 UCC UCA UCG UAU UGU) UAC Tyr UGCCYS Cys UUC UUA UUG. Ser UAA Stop UGA Stop UAG Stop UGG Trp Leu CUU CỤC CỦA CUG CCU CCC ССА CAU1 CÁC H CAA GIn CAG J CGU CGC Arg His Leu Pro CGA CGG CCGJ AUU AUC ile AUA AUG Met ACG AAU AAC А AGU ser Asn ACU АCC AGC Thr AGA Arg АCA AAG Lys GAUASP GAC, GAA AGG GGU GCU GCC GUU) GGC GUC Val GUA Gly Ala GGA GCA GCG Glu GAG G GGG GUG The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3. Starting from the start codon, what is the third amino acid incorporated into the polypentide chain OI. Cys O II. Met Glu IY, Gly Third letter UCAG UCAC UCAC UCAG 星 First letter

Q: How does this organism move?

A: When Monocystis is young, it is an intracellular parasite that lives in the bundle of developing…

Q: OCH3 H2C H;C CH3 EN] OH ÓCH, H CH3 ОН `N' H;C-N, H3C НО -OH он N-CH3 HO d H3CO HO OH H3CO HN OCH3…

A: We are only authorized to answer upto 3 sub-parts. Even then ,I am taking the liberty and answering…

Q: EcoRI 4359 Clal - BspDI 23 Hindi 29 Aatll - Zral 4284 Bki 4209 Borl 4205 EcoRV 185 Sspl 4168 Earl…

A: SCREENING OF POSITIVE RECOMBINANTS Since the gene of interest is inserted at the Sph-1 site, the…

Q: of vifomin c Woite atleast thrpe Yole in oUr body.

A: Vitamin C is also known as ascorbic acid and its active form is ascorbic acid.

Q: Cal- 2 Aal-rl 4254 4209 Wind 29 E 1 - Nhel 29 Sgr Seal 3 Rl 4s Pul 3733 Sall- At-n 5 Al 3 Eag s ll…

A: IDENTIFICATION OF RECOMBINANTS  Plating on to a selective medium enables the transformants to  Be…

Q: 5 ways to avoid life style deseases

A: Diseases or disorders are caused by several factors such as infection of foreign antigen,…

Q: duar ALLE STWOR ww ALIFOID SY 13 -88-88- 19 a DHE D THE GOD POCKE BOOK NOWN 14 PARA 98086 ... 20 CHE…

A: Introduction : The number and arrangement of all the chromosomes in the nucleus of a eukaryotic cell…

Q: 4. What is the process in which water is released from plants' leaves in the form of water vapor? a.…

A: Transpiration is the process of water movement through a plant and it's evaporation from the aerial…

Q: Bilirubin is converted from unconjugated into conjugated before entering the liver. False O True

A: Bilubirin is a pigment in bile and is formed through hemolysis, which is the breakdown of blood…

Q: Bacterial STI Viral STI Name of STI Chlamydia Genital herpes Effect on fertility and reproduction in…

A: We know that Sexually transmitted infections (STIs)are those that are transmitted between…

Q: What is the name of the COVID 19 disease can the name the COVID -19 virus

A: Answer. COVID-19  The SARS-CoV-2 stands for Severe acute respiratory syndrome coronavirus 2…

Q: A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a…

A: The central dogma of molecular biology posits that information within a living organism flows from…

Q: Which peptide is the least likely to be made on the ribosome and why?

A: Ribosomes are composed of two subunits, the large and the small subunit, both of which consist of…

Q: What are the different viral shapes and the different types of genomes they can have? Be very…

A: Viruses These are acellular microorganisms. They lack organelles, ribosomes, and plasma membrane.…

Q: Below you will find the normal p53 gene found on chromosome 17 and a mutated version of the gene.…

A: To solve such questions, we should know the corresponding complementarity between the bases and that…

Q: Antibiotic resistance can spread throughout a bacterial population through multiple mechanisms.…

A: The gene transfer between different individuals of bacteria can occurs through two types, that…

Q: COVID is a pandemic, after the 1918 Flu pandemic. COVID-19 is a zoonotic disease and the causative…

A: Covid-19 is a disease that is caused by a virus known as corona virus. It is a zoonotic disease that…

Q: What are the components of an enveloped virus

A: Virus- virus is the infectious agent which replicate only in the living organisms. Enveloped virus-…

Q: What is vesicular stomatitis virus (VSV-G protein)?

A: A virus is a submicroscopic irresistible specialist that repeats just inside the living cells of an…

Q: 6. 6. In contrast to nonrenewable, renewable energy sources produce little or no pollution or…

A: ( Comment: As per the guidelines,we are allowed to answer one question at a time, so I am answering…

Q: There are several corana virus in database, why is the SARS-CoV- 2 so dangerous

A: Coronaviruses (CoV) are a large family of viruses transmitting in animals and people that cause…

Q: Which Act required the reporting of COVID-19-related leave? Multiple Choice DOMA ARPA FMLA

A: Covid-19 was a pandemic caused by Corona Virus all over the world and hence it was declared as a…

Q: A A B ニV ニV 三 6. Use the photo above to answer the following questions: a. What are the larger round…

A: White blood cells are colourless, nucleated blood cells which lack hemoglobin and which participate…

Q: Purple flowers are dominant to white flowers. Identify the phenotype for the following genotype Ff,…

A: It is given that purple color is dominant over white color flower

Q: 10) Normal individuals Affected Individuals O Fill in the genotype in each circle and box using the…

A: By the Pedigree shown in the figure first of all we need to know what is the inheritance pattern by…

Q: Define coronavirus using the different techniques (negation , ramifications and historical…

A: Coronaviruses belong to the family called Coronaviridae. It is an enveloped virus that contains a…

Q: EboV Strain 1 EboV Strain 1 (Circle the mutated bases)  CCA TGT AAG TGG TTA mRNA…

A: In order to synthesise messenger RNA with the help of DNA template strand  RNA polymerases adds…

Q: A G UUU Phe UCU U UUC UUA UUG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop A Stop UGG Trp G Tyr UC…

A: The term protein is associated with a biomolecule form that gets generated after the polymerization…

Q: Person and blood Type  Probable Genotype  Possible Gametes  Mrs. Simons------A +  IAIA + -, IAi…

A: The classification of blood on the basis of presence or absence of antibodies is called a blood…

Q: estion 6! The largest chromosome in Mischievous gremlinus has a length of 9 x 107 base pairs. The…

A: The DNA molecule is bundled into thread-like structures called chromosomes in the nucleus of each…

Q: 3. How could you find the relative age of a sedimentary rock? 4. How might pieces of an igneous rock…

A: Sedimentary rocks are formed over years and it appears in layers. The bottom most akter is the…

Q: mph nodules have * Dthin capsule O thick capsule ) double capsule O regular capsule O devoid of…

A: Lymph nodule refers to a swelling or aggregation of cells in the lymph. They are protective in…

Q: lan's father keeps bees, and lan spends time observing their behavior. He is especially interested…

A: Honey bees are a social group of animals that exhibit complex behaviors to function well in a…

Q: I need help find the blank word

A: Viruses are on the border of the living and non-living world. They are non-living outside the host…

Q: what is the Laboratory diagnosis of influenza A virus subtype H1N1.

A: In virology, influenza A virus subtype H1N1 is the subtype of Influenza A virus. The outbreaks of…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.