Second letter C UUU Phe UCU1 UCC UCA UCG UAU UGU) UAC Tyr UGCCYS Cys UUC UUA UUG. Ser UAA Stop UGA Stop UAG Stop UGG Trp Leu CUU CỤC CỦA CUG CCU CCC ССА CAU1 CÁC H CAA GIn CAG J CGU CGC Arg His Leu Pro CGA CGG CCGJ AUU AUC ile AUA AUG Met ACG AAU AAC А AGU ser Asn ACU АCC AGC Thr AGA Arg АCA AAG Lys GAUASP GAC, GAA AGG GGU GCU GCC GUU) GGC GUC Val GUA Gly Ala GGA GCA GCG Glu GAG G GGG GUG The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3. Starting from the start codon, what is the third amino acid incorporated into the polypentide chain OI. Cys O II. Met Glu IY, Gly Third letter UCAG UCAC UCAC UCAG 星 First letter

Q: How does this organism move?

A: When Monocystis is young, it is an intracellular parasite that lives in the bundle of developing…

Q: duar ALLE STWOR ww ALIFOID SY 13 -88-88- 19 a DHE D THE GOD POCKE BOOK NOWN 14 PARA 98086 ... 20 CHE…

A: Introduction : The number and arrangement of all the chromosomes in the nucleus of a eukaryotic cell…

Q: Complete the following cross which exhibits codominance in human blood types by giving the genotype…

A: ABO blood types used to identify the presence of antigens. There could be the presence of one, both…

Q: Which peptide is the least likely to be made on the ribosome and why?

A: Ribosomes are composed of two subunits, the large and the small subunit, both of which consist of…

Q: 39 year old female had a sebaceous cyst on her right upper back.the cyst was infiltrated with 1/2%…

A: Sebaceous cyst is considered to be benign lesions beneath the skin. It may developed as a result of…

Q: HAIR COLOR 1. Select ANY allele to define your monster's hair color. It doesn't matter which one you…

A: Allele The variant form of a gene is defined as allele. These different forms of genes are located…

Q: What are the different viral shapes and the different types of genomes they can have? Be very…

A: Viruses These are acellular microorganisms. They lack organelles, ribosomes, and plasma membrane.…

Q: NSERTION OF CATHETERS INTO UTERUS TO FACILITSTE RADIATION THERAPY. WHICH COT CODE IS ASSIGNED? 49320…

A: CPT (Current Procedural Terminology) codes are used by healthcare professionals to bill the services…

Q: Below you will find the normal p53 gene found on chromosome 17 and a mutated version of the gene.…

A: To solve such questions, we should know the corresponding complementarity between the bases and that…

Q: Antibiotic resistance can spread throughout a bacterial population through multiple mechanisms.…

A: The gene transfer between different individuals of bacteria can occurs through two types, that…

Q: COVID is a pandemic, after the 1918 Flu pandemic. COVID-19 is a zoonotic disease and the causative…

A: Covid-19 is a disease that is caused by a virus known as corona virus. It is a zoonotic disease that…

Q: What are the components of an enveloped virus

A: Virus- virus is the infectious agent which replicate only in the living organisms. Enveloped virus-…

Q: What is vesicular stomatitis virus (VSV-G protein)?

A: A virus is a submicroscopic irresistible specialist that repeats just inside the living cells of an…

Q: 6. 6. In contrast to nonrenewable, renewable energy sources produce little or no pollution or…

A: ( Comment: As per the guidelines,we are allowed to answer one question at a time, so I am answering…

Q: Which Act required the reporting of COVID-19-related leave? Multiple Choice DOMA ARPA FMLA

A: Covid-19 was a pandemic caused by Corona Virus all over the world and hence it was declared as a…

Q: 10) Normal individuals Affected Individuals O Fill in the genotype in each circle and box using the…

A: By the Pedigree shown in the figure first of all we need to know what is the inheritance pattern by…

Q: text not picture please ASAP 1. What is SIDS?  2. What are its causes? 3. List one way parents…

A: Sudden Infant Death Syndrome: In short form , it is written as SIDS. It is a sudden, unexpected and…

Q: lan's father keeps bees, and lan spends time observing their behavior. He is especially interested…

A: Honey bees are a social group of animals that exhibit complex behaviors to function well in a…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.