Using the information provided below, which of the individuals A and B have: i) Genotypic change i) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q FP W A V Q T WY D SL GA I N.. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the MRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter A G UAUTv UGulcvs UACS UAA Stop UGA Stop A UAG Stop UGG Trp G UUU Phe UCU UCU UUC J UGCCYS UCC Ser UUA) UUG Leu UCG UCA CUU CUC CỦA CUG CAUTHIS CACS CAAGIN CGU CCU CCC CCA CCG CGC Leu Pro Arg CGA CAGJ Gin CG AAUAS AGUser AUU AUC le A AUA ACU ACC ACA AAC Asn AAA AGC Thr AUG Met ACG AAGLYS AGG JArg G. GUU GUC GUA GUG GCU GCC GEA Ala GGU GGC GAUT GACASP GGA Gly GAA GAG Glu GGG GCG G. First letter Third letter

Q: Why are the correct primer sequences essential for successful amplification?

A: Polymerase chain reaction (PCR) is a widely used method in molecular biology that is used to make…

Q: Which of the following pairs of sequences would be considered different alleles in DNA profiling?…

A: DNA profiling employs highly variable conserved regions known as variable number tandem repeats…

Q: Describe the following techniques for determining gene or protein function with advantages…

A:

Q: An experiment was performed in mice.  Wild-type bone marrow is used to reconstitute lethally…

A: The immune system is the body’s defense mechanism against infections and invading pathogens and is…

Q: My Avya mouse is brownish because a) the CpG island with the transposon is unmethylated. b) it was…

A: Epigenetic systems that facilitate gene-environment interactions are involved in the ability of…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: Short tandem repeat sequences (STRs) are a) used for DNA profiles b) repeat sequences present in…

A: STRs  ( short tandem repeat sequences) analysis is used as a method in molecular biology to compare…

Q: The phenotype of a heterozygous mouse (Aa) is agouti.  The agouti banding pattern is due to altered…

A: * Homozygous dominant and Heterozygous will produce agouti that is AA or Aa respectively  and the…

Q: 2. Sam is an immunologist who has designed a DNA vaccine for COVID-19. The vaccine has just entered…

A: In order to elicit an immune response, a DNA vaccine works by transfecting a particular…

Q: (6) Which of the following descriptions regarding human genetic variations is correct? A) Unlike…

A: SNPs may effect promoter activity or gene expression, messenger RNA ,conformation stability, and…

Q: lease write in digital format To mention: a) Types of mutations b) Mutagenic agents c) Genetically…

A: Types of mutations :  1. Point mutations  a) Substitution  b) Insertion  c) Deletion  2. Chromosomal…

Q: 11. Using the hypothetical pathway below, determine what proportion of offspring will be Orange if…

A: In this pathway, the presence of orange colour means the absence of C and the presence of A+ B in…

Q: What is the key component(s) of usher syndrome. A) The Effect of mutation and Hot-spots of mutation?…

A: Usher syndrome is a hereditary autosomal disorder passed down through the generations from parent to…

Q: [GAINI- is a protein coding gene that regulates cardiomyocyte metabolism in patients with heart…

A: Cardiovascular refers to the circulatory system. The circulatory system, which includes the heart…

Q: What is preimplantation genetic diagnosis?

A: Prenatal diagnosis is performed for the identification of genetic diseases and their predisposition…

Q: a. What is(are) the difference(s) between orthologs and paralogs? b. What are the main sources of…

A: Orthologs are homologs from different species that catalyse the same enzyme, while paralogs are…

Q: What is 15q?

A: Chromosomes are the DNA molecules with a portion or all of the genetic material of the organisms.…

Q: what are NOTCH1 gene mutations

A: Mutations are changes occur in the DNA sequences either by environmental factors such as UV rays and…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.