Two sets of sequenced DNA fragments for question #13 (A) In this example, a DNA sequence of 150 bases is cut with two different restriction enzymes, producing the following fragments, each of which has been sequenced. Fragments from the first restriction enzyme: GGTCGGCTATGTAACGAGTTGCC тсттоттсстассттотсAлСССGGGAТGAATOTTTACTO САCCCGGACCGTсссттCAT GTCCCAGAGCстаттасалаллат GCCCACCTT TTATTGAGTTGATGCTCGACGTAGCCAGACTTAA Fragments from the second restriction enzyme: ACCGGGGATGAATGTTTACTGGTCGCAGAG ссТАттасаAGAAатсатсааста сттетсA TGATGCTCGACGT сотссаттсAт AGCCAGACTTAACACGCGGAC тоталсаAOттоссосСсАCсттттATталот тсттеттсстаG Try to piece these fragmentary sequences together and determine the entire sequence of 150 bases, before you turn the page. Figure 4-8a Biology Today, 3le (0 2004 Garland Science)

Q: a. What are the purposes of sequence alignment?

A: Sequence alignment is a method by which one can arrange sequences of DNA, RNA and protein so as to…

Q: what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the…

A: Whole - genome shotgun sequencing is a single step sequencing method, in which the genome is broken…

Q: List and describe three important processes are affected by DNA supercoilin

A: DNA supercoiling is reffered to as under or "overwinding' of DNA strands. It is a crucial process in…

Q: Why is genome database and annotation relevant to Genome sequencing?   Are there any examples?

A: Genome: the set of genes. Genome database: it is the collection of all information on the human…

Q: List the critical steps in the ribosome profiling protocol and explain what this method is useful…

A: Ribosome profiling- it is carried out on a split sample, with parallel libraries constructed for…

Q: what are the purpose of sequence alignment? define local alignment and global alignment?

A: Alignments are an effective method for comparing similar DNA or protein sequences. DNA molecules are…

Q: What can serve as footprints to identify genome sites that are or have been occupied by transposable…

A: A genome is a collection of an organism's genetic information.

Q: Explain Two strategies for assembling whole genome sequences.

A: All the genetic information of an organism is known as its genome. Genome assembly is defined as the…

Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…

A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…

Q: How do shotgun and directed sequencing differ? Why is coverage an important issue?

A: Shotgun sequencing and directed sequencing are two different approaches in the field of DNA…

Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today?…

A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA…

Q: How are probes used to screen DNA libraries? Explain how a synthetic probe can be prepared when the…

A: A probe is an oligonucleotide stretch of DNA (Deoxyribonucleic Acid) or RNA (Ribonucleic Acid) which…

Q: How can the Ames test distinguish mutagens that cause small insertions/deletions from those that…

A: *Ames test  a biological assay to find the mutagenic potential of an chemical compound which…

Q: Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the…

A: Shotgun sequencing is an important tool in modern genomics that allows researchers to interpret the…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…

Q: Explain the basic techniques used to manipulate genetic material

A: Genetic Material:         A cell or an organism comprises information carrier materials found in the…

Q: rationale for column-based DNA extraction and purification.

A: Introduction DNA extraction is a technique that involves methods and procedures to isolate DNA from…

Q: Exaplain the two methods to study the contents of transcriptomes which are microarray analysis and…

A: Transcriptome analysis may be used to find novel genes and isoforms that are not already cataloged…

Q: In automated sequencing, you are given a printout of the sense strand of your DNA.  The printout is…

A: Introduction Nucleic Acids:- Nucleic acids are biopolymers, macromolecules, essential to all known…

Q: tail the process of Sanger sequencing. Include a diagram

A: Sequencing of genetic material involves visualizing the number and arrangement of base pairs. It is…

Q: Specify the method for Purification of DNA fragment after digestion.

A: Dna is the polymer formed by monomer units called nucleotides . The dna molecule when degraded…

Q: Use the data in the table below and the gel picture to create a graph (using the graphic paper…

A: The given data states fragments created by BamHI, EcoRI , HindIII as represented in Agarose Gel…

Q: In the procedure called RNA sequencing (RNA-Seq), what type ofmolecule is actually sequenced?

A: Ribonucleic acid sequencing (RNA-seq) was developed by Michael Snyder and colleagues in 2008. It is…

Q: what kinds of techniques are used to sequence large fragments of dna upto 50kb

A: With the advancement of science and technology in the field of life sciences, there has emerged…

Q: Why are the proteins cleaved into small fragments for protein sequencing?

A: Proteins are the end product of the molecular translation that codes the information present in the…

Q: Define the Single-cell sequencing (SCS) ?

A: Working of Single-cell deoxyribonucleic acid genome sequencing involves analytic one cell,…

Q: Briefly explain how synthetic probes are created to screen a DNA library when the protein encoded by…

A: Synthetic probe is fragment of DNA. to screen a DNA library RNA of variable length approximately 100…

Q: Explain the sequencing-by synthesis (SBS) approach ?

A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…

Q: Convert to cDNA and add linkers

A: This is the High-throughput sequencing that analyzes DNA/RNA genome and becomes the standard tool…

Q: Draw the structure of a typical insertion sequence and identify its parts.

A: There are two types of transposons such as replicative and non-replicative transposons. They are…

Q: Outline different strategies for identifying gene sequences.

A: Genome is the study of all genes present in the organism. Gene is a unit of heredity that is…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.