True or False 1. Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 2. DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact. 3. A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between base pairs is 0.34nm.

True or False 1. Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 2. DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact. 3. A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between base pairs is 0.34nm.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Similar questions

TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure
TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of the molecule.12. The stacking position of the nitrogenous bases is caused by intramolecular Van der Waals Interaction.13. The histone complex is a quaternary protein structure.14. The difference between ribose and deoxyribose is in the presence of oxygen in carbon number 3 of the sugar moiety.15. The sedimentation coefficient of the nucleic acid is higher compared to ribosomes.
Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?
TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of previously formed Okazaki fragments. 2. All tRNAs have the sequence -CCA at their 5’terminus. 3. Termination of translation does not require the hydrolysis of any high-energy phosphate bonds. 4. Assembly of a complete ribosome onto mRNA requires GTP hydrolysis.
An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.
Please help me with this please. I really don't know how to make this. I really do appreciate you're help. 1. make a simple illustration to relate the different kinds of DNA to its function.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
TRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via single stranded annealing.
True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…
The Basic Structure of DNA 1. Nucleotides are the monomer subunits of DNA polymers. Review the structure of a nucleotide by labeling the three main parts: the sugar, the phosphate group and the nitrogenous base of the one shown below. NH2 N- || ОН 2. Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? 3. Based on the complementary base pairing rules we know that: A(denosine) pairs with and that G(uanine) pairs with 4. What two types of bonds are found in a DNA molecule and where are they found? а. bonds are found b. bonds are found O=a-o
7 Protein structure.Circle one of the three amino acid sequences that is most likely to form a stable a-helix? RASKTARQ DASKTAEQ KPGKPAGQ In one sentence (that can be accompanied by a small picture) explain why?