Which of the following is an RNA nucleoside?cytosine and riboseBa phosphate group, uridine and ribose(C) thymine and riboseadenine anda phosphate group

Nucleosides- these are the compounds which contains only sugar and base and no phosphate groups are…

Answered: Which of the following is an RNA…

Science

Biology

Which of the following is an RNA nucleoside?

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 2RQ: Which of the following does cytosine pair with? a. guanine b. thymine c. adenine d. a pyrimidine

See similar textbooks

Related questions

Q: Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…

A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…

Q: DNA and RNA are chemically very similar but are distinguished, in large part, by the presence of a…

A: Deoxyribose and Ribose sugar of DNA and RNA two are very similar in structure, with just one…

Q: Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna…

A: In molecular biology, the process of protein synthesis involves the conversion of genetic…

Q: Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA…

A: Mutations are sudden changes in the genetic material which can be either DNA or RNA.Molnupiravir is…

Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…

A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…

Q: hat is important about each of these carbons on the deoxyribose/ribose found in DNA and RNA? 1’: 2’:…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: Which of the following is a nucleoside monophosphate? GMP Adenosine UTP ADPUDP

A: The objective of the question is to identify which among the given options is a nucleoside…

Q: The purine and pyrimidine rings are built from the amino acids aspartate,glutamine, and glycine. Why…

A: A deoxyribonucleotide is a nucleotide that contains deoxyribose. They are the monomeric units of the…

Q: For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’?…

A: The nucleic acid is the type of macromolecules found in all living organisms. The DNA is made of…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: How many cases are there in which it would be possible to identify the first two nucleotides of a…

A: Codon is a three nucuclotide sequence on mRNA that determines the amino acid sequence in newly…

Q: RNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence…

A: There are four nucleotides present in RNA and they are adenine, guanine, cytosine and uracil which…

Q: According to Chargaff's rule of nitrogenous base pairing, which of the following statements is…

A: The genetic material of the cell (DNA, deoxyribonucleic acid) is made of deoxyribonucleotides. DNA…

Q: If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what…

A: Polynucleotide with ribonucleotides as mononucleotides is known as a polyribonucleotide. Nucleic…

Question

Which of the following is an RNA nucleoside?
cytosine and ribose
B
a phosphate group, uridine and ribose
(C) thymine and ribose
adenine anda phosphate group

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is a DNA nucleotide? a phosphate group, guanine and deoxyribose a diphosphate group and uridine thymine and deoxyribose a phosphate group, adenine and ribose
Which of the following is true of an RNA molecule? the number of purines always equals the number of pyrimidines the number of thiamines may or may not equal the number of adenines the number of purines may or may not equal the number of and pyrimidines the number of cytosines always equals the number of guanines
Which type of covalent bond is present in a “charged” transfer RNA molecule (with an amino acid attached), but absent in an “uncharged” transfer RNA molecule (without an amino acid attached)? the aminoacyl bond the phosphodiester bond the peptide bond the glycosidic bond the ether bond
Which of the following combinations is nucleotide molecule? The nitrogenous base uracil bonded to ribose and phosphate complemented with the addition of a water molecule A nucleoside resulting from the dehydration reaction between two phosphates, glycerol, and an unsaturated fatty acid. The DNA backbone consisting of three phosphate groups, a 5-carbon nitrogenous base, and a nitrogen-containing sugar residue An ATP molecule is formed by combining adenine, ribose, and three inorganic phosphate groups
Which of the following statements is correct Adenine is a purine and uridine is a pyrimidine Thymidine is a pyrimidine Adenine and guanine are both purines. Adenine and cytosine are pyrimidines
Which of the following statements is not true? O RNA contains ribose and DNA contains deoxyribose O RNA contains uracil and DNA contains thymine RNA is single strand while DNA is double strand RNA contains nucleosides and DNA contains nucleotides Cle
Pyrimidines built from a single carbon ring are: a. cytosine and thymine. b. adenine, cytosine, and guanine. c. adenine and thymine. d. cytosine and guanine. e. adenine and guanine.
__________ consists of nucleotides. a. Ribose b. RNA c. DNA d. b and c
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
The RNA components of ribosomes are synthesized in the _____. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum
Which statement about N-linked glycosylation is correct? N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmicreticulum. N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation inthe cytoplasm. N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation inthe Golgi apparatus.
Which of the following statements about RNA are true? (choose all that apply) O it is a polymer composed of amino acid subunits O it is assembled into much shorter lengths than DNA O it sometimes forms spirals O RNA functions include the transfer the information coded in DNA to the ribosomes, where proteins are manufactured O it is a polymer composed of multiple lipid subunits O it is composed of nucleic acids