TRANSLATE this RNA sequence: AUGCAAUGAMet-Gln-StopMet-His-StopThr-Glu-StopThr-Pro-StopWhat would happen if the nitrogen base second to the last of the sequence willundergo a point mutation, (G turning to A)Met-Gin-StopMet-His-StopThr-Glu-StopThr-Pro-StopThe DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acidsare coded for by this message?O 48.1220Option 5For the lab part: how is DNA used for catching crime suspects. Describe theprocedure and cite a particular example where it helped solve a case or absolvedan innocent person from any wrongdoing.Your answerO O

We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Answered: TRANSLATE this RNA sequence: AUGCAAUGA…

Science

Biochemistry

TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop O Thr-Glu-Stop O Thr-Pro-Stop

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: Normal sequence: DNA: MRNA: GGA CCU prline CTC GAG glutamic acid CTC GAG glutamic acid Amino Acids:…

A: Normal sequence: DNA: GGA CTC CTC mRNA: CCU GAG GAG Amino Acids: proline glutamic acid glutamic…

Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA

A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…

Q: Use the following segment of DNA to determine the mRNA and amino acid sequence that would form.…

A: DNA and RNA are two different forms of nucleic acids, which are biological polymers of nucleotides.…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein: AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Use the codon chart to translate this RNA sequence into amino acids. *Hint* Pay attention to start…

A: When we have to translate a genetic sequence into amino acid we use stand table known as codon chart…

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: How long would the peptide be that is translated from this MRNA sequence: 5'-AUGGGCUACCGA-3'?a. 0b.…

A: TRANSLATION It is the process of peptide formation by the reading of mRNA in 5' - 3' direction.

Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Write a possible mRNA sequence that codes for each peptide. a. Ile–Met–Lys–Ser–Tyr b.…

A: The genetic code is a series of rules that living cells use to convert information found in genetic…

Q: DNA message #6: GTA-CGA-TGA-ACA-GTG-CTT-TGC Transcription to mRNA: CAU GCU ACU UGU CAC GAA ACG…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Write a possible mRNA sequence that codes for each peptide. a. Phe–Phe–Leu–Lys b.…

A: Answer- mRNA serves as the template for the synthesis of proteins. The polypeptides are generated by…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Match each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA)…

A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…

Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’

A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: Translate the following mRNA codons: 5' AAG UGG CAU ACG - 3' Write your answer in order (first codon…

A: Translation in molecular biology is the process by which the RNA of the cell is read and comment…

Q: Please help transfer CAT AGG GAG to mRNA

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…

A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…

Q: Which amino acid sequence is coded for by the mRNA segment AUG-CCC-CAC-GAA-UAC? Met-Pro-Gin-Asp-STOP…

A: Amino acids are organic compounds that are joined together to form proteins. Amino acids and…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…

A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA mRNA - Complementary to…

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows, TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: Transcribe and translate the RNA. AUG GAG CAU CCU UGG GCA GCC UUA

A: Transcription and translation Transcription is the process when the DNA is converted into RNA. and…

Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'

A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…

Q: Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome,…

A: Macromolecules are very large molecules commonly composed of the polymerization of smaller subunits…

Q: TAC TGA TCG ACC CCC ATA ATG AAAAIC MRNA TRNA AA

A: The given sequence is anti-sense strand of the given gene. The anti-sense strand is in the direction…

Q: DNA MRNA > UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein > start - glu - ala…

A: The four major bases, commonly known as nucleotides, make up deoxyribonucleic acid (DNA). Adenine…

Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…

A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…

Q: TAG CCG ATA GCT TGA Translate the gene above into a protein . Please write the three letter code…

A: Codon is a sequence of three nucleotides that encodes an amino acid. Codons together form a unit of…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

Q: BONUS: Within a cell, positive sense single stranded RNA acts as O FRNA O SİRNA tRNA O MRNA

A: Introduction: Positive-strand RNA viruses or +ssRNA viruses are a group of viruses that are related…

Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…

Q: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base…

A: Central Dogma It is the process by which the instructions in DNA are converted into a functional…

Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is : a. 4 b. 5…

A: The three letter codes for amino acids are the universally accepted amino acid codes that are…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…

A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…

Q: Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation…

A: The start codon for eukaryotes is methionine. There are different initiation codons for different…

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…

Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…

A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…

Q: The mRNA codon of valine is GUC UGG CCA TTG

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Question

TRANSLATE this RNA sequence: AUGCAAUGA
Met-Gln-Stop
Met-His-Stop
Thr-Glu-Stop
Thr-Pro-Stop
What would happen if the nitrogen base second to the last of the sequence will
undergo a point mutation, (G turning to A)
Met-Gin-Stop
Met-His-Stop
Thr-Glu-Stop
Thr-Pro-Stop
The DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acids
are coded for by this message?
O 4
8.
12
20
Option 5
For the lab part: how is DNA used for catching crime suspects. Describe the
procedure and cite a particular example where it helped solve a case or absolved
an innocent person from any wrongdoing.
Your answer
O O

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.