Answered: Transcription occurs along a_template…

Name: Transcription occurs along a_template forming an MRNA in the_directio
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Transcription occurs along a_template forming an MRNA in the_direction. *O none of the aboveO 5' to 3'; 5' to 3'O 5' to 3'; 3' to 5'3' to 5'; 3' to 5O 3' to 5'; 5' to 3'

Science

Biology

Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5' to 3'; 5' to 3' O 5' to 3'; 3' to 5' 3' to 5'; 3' to 5 O 3' to 5'; 5' to 3'

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 17RQ: An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size...

See similar textbooks

Related questions

Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…

Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…

A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…

Q: What would be the most likely effect of moving the AAUAAAconsensus sequence shown in Figure 14.7 10…

A: mRNA (messenger ribonucleic acid) is synthesized using DNA (Deoxyribonucleic acid) template. After…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A…

A: IntroductionIn eukaryotic mRNA, there are two important structures that are added to the ends of the…

Q: Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA…

A: RNA splicing is a kind of RNA processing in which a newly made precursor-mRNA is transformed into a…

Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…

A: DNA is two stranded ladder like structure which comprises of :- A) Coding strand B) Template…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…

A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…

Q: Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and…

A: Three subsequent nucleotides present in the mRNA are known as the genetic codon. Their are total of…

Q: Matching type Choices are in the picture 6. RF1 and RF2 recognize the three bases to terminate the…

A: Transcription is the process in which the DNA molecule information is copied into RNA molecule. The…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: Part 5: What is the amino acid sequence if G is added to the beginning of the chain? Answer The…

Q: Quick activity Use the genetic code to translate the following 30 nt mRNA sequence:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene.…

A: DNA (deoxyribonucleic acid) is a double stranded molecule. One strand present in the 5’ to 3’…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

Transcription occurs along a_template forming an MRNA in the
_direction. *
O none of the above
O 5' to 3'; 5' to 3'
O 5' to 3'; 3' to 5'
3' to 5'; 3' to 5
O 3' to 5'; 5' to 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If the template DNA is 3' A GCTAC5' then the mRNA sequence is O 5'UCGAUG 3' O 5'TCGATG 3' O 3'UCGAUG 3' O 3'TC GATG 5'
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
Please help with this
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'
For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site, (b) template strand, and (c) promoter.