Tn10 has a ____________ structure and it is composed of a pair of insertion sequence elements (IS10) flanking five genes

Q: summary paragraph describing lysozyme and what it does

A: Lysozyme is a important enzyme perform verious important role in body. Lysosome helps in the…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: One way to control metabolic pathways, or other conditions that involve proteins, is to regulate the…

A: The lac operon is a genetic system found in bacteria that regulates the metabolism of lactose. It…

Q: HpaI --- 5' GTT - AAC 3' 5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual A IV-3 Phenotype…

A: Chromosomes are the rod shaped, dark stained bodies which are most prominently seen in the metaphase…

Q: Pregnant women often experience numbness in their fingers and toes. Why? Please, answer on your own…

A: Tingling, numbness, and pain in the hands are common during pregnancy, especially in the last…

Q: The “start” codon is ____ - ____ - ______

A:

Q: Can I please have help with this question,thank you!

A: The process of protein synthesis is accompanied by several functional steps and mechanisms followed…

Q: How ribosomes cannot do it's normal job in treacher Collins Syndrome disorder

A: Cell organelles are essential parts in a cell for various cell functions. So any undesirable damage…

Q: This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUC GGACUUAGUAAGGACUGACAUA A-3' As…

A: The mRNA is produced from the DNA template strand by the transcription process. This mRNA contain…

Q: An experiment that shows that there is a targeting system for a nuclear encoded protein that…

A: Proteins are being synthesized on the endoplasmic reticulum and targeted to their destination…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.