Through wobble, a single ____________________ can pair with more than one ____________________. a. codon, anticodon b. group of three nucleotides in DNA, codon in mRNA c. tRNA, amino acid d. anticodon, codon

Through wobble, a single can pair with more than one . a. codon, anticodon b. group of three nucleotides in DNA, codon in mRNA c. tRNA, amino acid d. anticodon, codon

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Related questions

Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…

Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…

A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…

Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…

A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…

Q: RNA polymerase binds to a _________ to initiate _________. a. mRNA; translation b. promoter;…

A: RNA polymerase is the enzyme that is responsible for the synthesis of mRNA from genomic DNA.

Q: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose…

A: Given condition: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides. Mutation…

Q: Prokaryotic transcripts are _____________ since several proteins can be produced from one mRNA. a.…

A: Introduction : Transcription is the process in which a genes DNA is copied to make an RNA molecule.…

Q: A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the gene is extracted…

A: Molecular Biology is the field of biology that studies the composition, structure and…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C A T G Changes to A T C…

Q: if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following

A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…

Q: Use the first picture and codon table to answer the following questions.

A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…

Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…

A: Given: a sequence of amino acids, serine-valine-lysine-leucine

Q: A polypeptide is composed of 4 amino acids. How many nucleotide bases on an mRNA strand are…

A: The relation between the sequence of nucleotides of messenger ribonucleic acid (mRNA) and the amino…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

Through wobble, a single ____________________ can pair with more than one ____________________.

a. codon, anticodon

b. group of three nucleotides in DNA, codon in mRNA

c. tRNA, amino acid

d. anticodon, codon

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Below is a segment of RNA, transcribed from a DNA sequence. Use the codonchart to help answer the questions below. 5’ AUG/CCU/ACG/GAC/UGG/CCU 3’ a. What polypeptide would be generated by this sequence? b. The RNA is mutated to: 5’ AUGCCCACGGACUGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. c. The RNA is mutated to: 5’ AUGCCUACGGACGGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. d. The RNA is mutated to: 5’ AUGCCUACGGACUGACCU 3’. What type of mutationhas occurred? Show the new polypeptide chain.
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________
Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________
Complete the following table and answer the next two questions. DNA____________strand T A G DNA____________strand G G C mRNA codon G U tRNA anticodon U C A ________ __________ ________ __________ ________ Amino acids for each three CGT ACG CTC TAG CCA
Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T G G This would be an example of which type of a point mutation?__________________________
Use the first picture and codon table to answer the following questions.
Ribosomal RNA ____________________. a. Carries amino acids to the ribosome b. Carries information from the DNA to the ribosome c. Helps make up the ribosome d. Carries oxygen to cells
Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information from the DNA to the ribosome c. Helps make up the ribosome d. Carries oxygen to cells
An enzyme known as ___________________ attaches an amino acid to the_________________ of a tRNA, thereby producing_______________ . a. aminoacyl-tRNA synthetase, anticodon, a charged tRNA b. aminoacyl-tRNA synthetase, 3′ single-stranded region of the acceptor stem, a charged tRNA c. polynucleotide phosphorylase, anticodon, a charged tRNA d. polynucleotide phosphorylase, anticodon, an aminoacyl-tRNA
Choose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. introns
Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T T C This would be an example of which type of a point mutation?__________________________