This is the same gene as #1, a. Where in the gene is the mutation? (promoter, 5'UTR, 3'UTR, start codon, stop codon, coding region ...) b. Transcribe and translate the gene now C. What type of mutation is this? 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATTATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAATAATGTAACTGATTGC -5' --- ---- ———

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: A deletion mutation occuring in the region of DNA which encodes for a sigma subunit of RNA…

A: Mutation is sudden, heritable change in the sequence of the genome that give rise to alternate form…

Q: a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: C<-> A, G   G<-> C,T   CGG transversion are the following   1 ACC   2 ACT   ЗАТТ   4 ATC…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…

A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological…

A: Antibiotic is a substance released by any microorganism against other microorganism. These…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: 1. Using the data available describe the phenotype that you observe when each of these three genes…

A: The question is related to the use of RNA interference (RNAi) to study the function of specific…

Q: Following the spill of a mixture of chemicals into a small pond, bacteria from the pond are tested…

A: When a chemical spill occurs, particularly in a biologically dynamic environment like a pond, the…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: The figure shows the position of two of these mutations a and b. The nucleotides are altered in…

A: Note: Your question has 4 sub parts and as per our instructions we ara able to answer only three.…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: a. promoter region b. RNA polymerase C. antisense strand d. poly-A tail e. 5' cap f. splicing 8.…

A: Introduction :- A promoter is a DNA region where RNA polymerase starts transcription of a gene.…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…

A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…

Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…

A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Molecular biology is the study of biological processes at molecular level. It includes various…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: What type of mutation causes the "mutant" variety of the PTC gene?  a A point mutation which lead…

A: PTC gene: it is the premature translation-termination codon. PTC is responsible for about one third…

Q: In Figure 6-1,a. what do the yellow stars represent?b. explain in your own words why the…

A: Each gene has two copies, also known as alleles, where each allele contributes 50% to the protein…

Q: a. What is grey donut shaped object supposed to represent? b. Label with the word "promoter" where…

A: Transcription is the first step of the central dogma, it is a process where an RNA transcript is…

Q: A. In an E. coli gene that uses rho dependent termination, the rut site has been deleted. What…

A: The production of RNA from the DNA template is known as transcription process that occurs within the…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A:

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: What mutation could cause the following error in the second mRNA sequence? Normal: AUAUUCGGCAAUCCG…

A: The mutation is the process that brings changes in the DNA sequence spontaneously and as a result,…

Q: Identify the best match between the mutation description and term.   a. Transversion: results in a…

A: Often mutation occurs in our body. These mutations can be beneficial or lethal. The mutation occurs…

Q: What is Akaryotic

A: Ans-  Akaryocytes are cells without a nucleus, also known as akaryotes or acaryotes. Viruses are the…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.