The white stringy filament that appears at the end of DNA extraction experiment is a.?O a. Nucleic acidO b. Mixture of DNA, RNA and proteintofO c. Pure RNAO d. Pure DNAe.All answers are correctNEEVIOUS PAGEO Type here to search立

DNA extraction is done to extract the genetic material. In smaller laboratories, the DNA extraction…

Answered: The white stringy filament that appears…

The white stringy filament that appears at the end of DNA extraction experiment is a.? O a. Nucleic acid O b. Mixture of DNA, RNA and protein O c. Pure RNA O d. Pure DNA O e. All answers are correct

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter15: Biotechnology

Section: Chapter Questions

Problem 6SA

See similar textbooks

Related questions

Q: Next generation sequencing using Illumina platforms identifies individual bases in a DNA fragment…

A: The following steps are involved in next generation sequencing: 1) First the DNA sequencing…

Q: You have extracted a long piece of DNA from a human cell and you want to extract the gene of…

A: Genes are a series of instructions that govern how an organism looks, how it survives, and how it…

Q: Select all of the following that need to be in a polymerase chain reaction that will successfully…

A: Polymerase chain reaction (PCR) is a molecular technique used by scientists to multiply particular…

Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…

Q: What causes the DNA to migrate from the wells toward the positive electrode? a) DNA is positively…

A: ANSWER;- b) DNA is negatively charged, and so was attracted to the positive electrode Explain;- DNA…

Q: About transcriptomics and genomics, answer: 4. Can we replicate RNA? How can we use PCR and Sanger…

A: (a)RNA viruses can replicate their RNA. RNA can store and replicate genetic information. RNA…

Q: What are the main components needed for electrophoresis? a) A power source b) A gel matrix c) A…

A: 1. Option e is the correct answer All of the above are required for electrophoresis.

Q: In gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules…

A: Answer is b.) have different lengths.

Q: A cell sample suspended in a buffer solution was centrifuge at 12,000 rpm. Which of the following…

A: Centrifugation is a frequently used techniques in the cell and molecular biology laboratory. It is a…

Q: PCR is used to: Select one: a. Randomly break large pieces of DNA or plasmids into smaller…

A: PCR ( polymerase chain reaction ) is used to amplify a specific segment of DNA . Amplification is…

Q: The BLAST program is a tool fora. inserting many DNA fragments into a cell at the same time.b.…

A: With the formation of molecular biology as a branch of science, scientist began to work on the…

Q: The polymerase chain reaction uses Taq polymerase rather than a DNA polymerase from E. coli, because…

A: Taq polymerase is use to amply the DNA in polymerase chain reaction

Q: h of the following is NOT true of cutting DNA in biotechnology? A molecular biologist can cut DNA…

A: Biotechnology is a technique in which DNA is manipulated either by cutting the the and required gene…

Q: Each cycle of amplification in PCR involves all of the steps EXCEPT: A annealing of…

A: In the 1980s, Kary Mullis developed the PCR (Polymerase Chain Reaction) method. PCR makes use of DNA…

Q: In a sequencing reaction, the dATP was left out of the tube.What would be the result of this…

A: Polymerase chain reaction (PCR) is a technique broadly used to quickly make millions to billions of…

Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…

A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…

Q: With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy…

A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…

Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…

A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…

Q: One common feature of all DNA polymerases is that they a. synthesize DNA in the 3′-to-5′…

A: One common feature of all DNA polymerases is that they synthesize DNA in the 5'-3' direction.

Q: How are DNA fragments separated on an agarose gel duning electrophoresis ? A. The electric…

A: We only provide first question in case of multiple question posted . Please repost the other…

Q: Which enzyme is used in Sanger sequencing reactions? O A. DNA polymerase O B. S1 endonuclease O C.…

A: Introduction :- Sanger DNA sequencing is commonly employed in research to target smaller genomic…

Q: Which is not a property of DNA polymerase? a) It requires a primer to begin synthesis b) It adds…

A: Note : As many questions have been asked, only the first multiple choice question (question number…

Q: Which statement is true? a. There is no danger involved in recombinant DNA research in humans.…

A: Introduction Recombinant DNA (rDNA) is a technique for cutting and pasting DNA sequences of interest…

Q: When working with the gel electrophoresis chamber, what must we keep in mind? A. Keeping the gel…

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charge under…

Q: The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they…

A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors used in the Sanger technique of…

Q: E) double stranded DNA separates into single stranded DNA

A: The correct option is E . Double stranded DNA separates into Single stranded DNA .

Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…

A: DNA Polymerase is the main enzyme of replication. It adds deoxyribonucleotides according to the…

Q: the most efficient general strategy for whole genome sequencing is ? (a) double the coding sequence…

A: Whole-genome sequencing abbreviated as WGS is a method used to comprehensively analyze the entire…

Q: What purpose do short DNA primers serve in PCR? O They determine which sequence of DNA is copied O…

Q: DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new…

A: DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…

Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that…

A: Introduction: Polymerase chain reaction is a method which is used to amplify a small amount of DNA…

Q: Based on the following image: A) Identify the largest DNA fragment in sample 5. Explain your…

A: In the given question, an agarose gel is shown which is having bands of DNA in different lanes. DNA…

Q: Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases?…

A: A DNA polymerase is the member of family of enzymes that catalyze the synthesis of DNA molecules…

Q: 100 F В A 75 80 85 90 95 100 105 110 115 120 125 Temperature (°C) A) What is the tm of the most…

A: DNA is a double-stranded helical molecule. The monomer of DNA is a nucleotide. A nucleotide…

Q: If we extract DNA of a pool of cells, will that impact the DNA sequencing? In other words, having…

A: Since we only answer one question at a time according to our honor code, therefore we’ll answer…

Q: You used agarose gel electrophoresis to separate DNA fragments of different size and the experiment…

A: Agarose gel electrophoresis is a method to separate, identify and purify the DNA molecules.…

Q: You discover an E. coli mutant that has a non-functional DNA polymerase III. Such a bactèria; a)…

A: The DNA replicates itself several times during the replication process. It is a biological…

Q: 1. What is the basis of separation of different DNA fragments by gel electro- phoresis? a. The…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: What is the reason that the Taq polymerase is currently used? A the Taq polymerase is one of the…

A: Taq polymerase is obtained from a thermophilic (those organisms which can survive in very high…

Q: Arrange the following steps in the sequence they would happen in a DNA cloning experiment. a.…

A: DNA is an important biomolecule present in the cell as it is responsible for various traits…

Q: Put the following tasks in the order they would occur during a DNA cloning experiment. a. using DNA…

A: Restriction enzymes are restriction endonuclease that recognizes particular restriction sites on the…

Q: Place the following stages of a physical mapping study in theirmost logical order:A. Clone large…

A: Artificial chromosome- laboratory constructed cloning vectors that carry larger DNA insert than…

Q: With regard to DNA microarrays, answer the followingquestions:A. What is attached to the slide? Be…

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: . If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long…

A: Introduction :- DNA polymerase is an enzyme which shows 5' - 3' polymerase activity , because it…

Q: When a dideoxyribonucleotide is incorporated into a growingDNA strand,a. the strand elongates…

A: Given: Explain when a dideoxyribonucleotide is incorporated into a growing DNA strand, choose the…

Q: Find out whether the following are true or false. a)Klenow polymerase is E. coli DNA polymerase I…

A: Polymerase chain reaction involes denaturation, annealing and extension steps at varied temperature…

Q: What happens if your ratio of ddNTPs to dNTPs is too high in a Sanger sequencing reaction? a) Most…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

The white stringy filament that appears at the end of DNA extraction experiment is a.?
O a. Nucleic acid
O b. Mixture of DNA, RNA and protein
tof
O c. Pure RNA
O d. Pure DNA
e.
All answers are correct
NE
EVIOUS PAGE
O Type here to search
立

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction:

VIEW

Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. . O a. Filtrates the contents of the blender to collect the strained fluid for DNA extraction O b. Precipitate the nucleic acid OC. Separate the DNA from the protein that folded and protected the DNA O d. Collect pure nucleic acid O e. Filtrate the mixture and precipitate the protein e here to search hp
The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to release the nucleic acid O b. Precipitate the DNA O c. Breakup the DNA O d. Cut the proteins away from DNA O e. Strain the mixture Type here to search 立

If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.g
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. AAAAAATTTTTCCCCCGGGGG O c. GGGGGCCCCCAATTCCCCCCC O d. TACТАСАСTGTGGTTААТТААA O e. GCGCGCGCGCGCGCGCGCGCG ype here to search Chp
Four enzymes are listed below, match each to the correct definition. Definition Enzyme 4. Ligase 5. Primase 6. Gyrase 7. Helicase Answer a. Unwinds DNA b. Relieves tension in DNA during unwinding c. Links sugars and phosphates together d. Builds RNA primers C В A
B. 25mL of 1% Sodium Bicarbonate solution was created and the ph was taken. Whic value below represents the most accurate representation fo the pH of the solution? a. pH 8.5 b. pH 7.0 c. pH 6.5 8. Agarose gel electrophoresis was performed below. Lane 1 is a 100 base pair DNA ladder. 1 2 3 Divong 20dut arinat & bak A. Does Lane 2 or lane 3 show a larger DNA fragment? B. Given the Lane 1 DNA ladder sizes, what is the approximate size (in base pairs) of the amplicon in Lane 3?
A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
The rate of migration of DNA within an agarose gel in the gel electrophoresis technique is dependent on what factor(s)? Select one or more: a. G-C /A-T ratio b. Well size of the gel c. Size of DNA fragment d. Volume of sample loaded e. Negative charge of DNA
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
Which of the following enzyme:function pairs is/are correct? a.primase:forms RNA primer b.ligase:join Okazaki fragments c.gyrase:relax supercoils d.DNA POI ll:removes RNA primers
What type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertion
DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis. Which fragment will migrate farthest in the gel? a. The 2000-bp fragment b. The 1000-bp fragment c. The 500-bp fragment d. All will migrate equal distances.