All of the following statements are correct EXCEPTa. DNA forms described by Watson and Crick have right handed helix except of Z-DNA formb. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure"c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciformd. Plasmid carries genes that convey antibiotic resistance to the host bacterium P Flag questionAll of the following statements are correct EXCEPTa. DNA forms described by Watson and Crick have right-handed helix except of Z-DNA formb. In case of Z-DNA form, the deoxyribose phosphatebackbone forms a "Zigzag structure"c. Inverted DNA sequence repeat that happens withineach individual strand of the DNA, called cruciformd. Plasmid carries genes that convey antibiotic resistanceto the host bacteriumNevt p e

Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have right handed helix except of Z-DNA form b. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure" c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciform d. Plasmid carries genes that convey antibiotic resistance to the host bacterium

All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have right handed helix except of Z-DNA form b. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure" c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciform d. Plasmid carries genes that convey antibiotic resistance to the host bacterium

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
All are true for DNA polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / genereer dsDNA vanaf SSDNA B. requires a primer with a free 5'- OH end, but the 3'-end may be phosphorylated / benodig 'n voorvoerder met 'n vrye 5'-OH-groep, maar die 3'-einde kan gefosforileer word. C. copies the sequence of nucleotides of one strand in a complementary fashion. / kopieer die volgorde van nukleotiede van een streng komplementêr. D. synthesizes new strands by adding successive nucleotides in the 5'→3' direction. / sintetiseer nuwe stringe deur opeenvolgende nukleotiede in die 5 '→ 3' rigting toe te voeg. E. copies the sequence of nucleotides of one strand to form a new second strand. / kopieer die volgorde van nukleotiede van een
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Bacteriophage T7 helicase movesalong DNA in the 5' -to-3' direction.Other helicases have been reportedto move in the 3' -to-5' direction. Isthere any fundamental reason why you would expect helicases to move in one direction or the other?
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV