The redox potential of comminuted meat is thus favours the growth of microbes. Microorganisms protect themselves againct ocm threugh the

Q: Can you please write which letter would be the answer for each question? (a,b,c,d,e,f are the…

A: The building blocks of both DNA and RNA are nucleotides. A nucleotide has a base, a sugar molecule,…

Q: https://docs.google.com/document/d/1p9yf6Z3bcuD8h1fAg8uJy-ikoR3nMpvsDmClUI2wQT4/edit?usp=sharing…

A: P. A. is a 52-year old man presented with a 2-week history of polyuria, polydipsia, polyphagia,…

Q: A few proteins are naturally fluorescent, what physical and chemical factors of the proteins allow…

A: Fluorescent proteins have been appreciated in the field of biology because of their contribution in…

Q: write about mitochondrial DNA.

A: Mitochondrial DNA is a circular double-stranded DNA composed of heavy and light chains ,which…

Q: Make a dichotomous key for beauty product or cleaning agent.at least 10 items. plse this is the…

A: A dichotomous key is a significant instrument, used to recognize various living beings or things,…

Q: Write about typeB, typeA and typeZ DNA.

A: DNA is deoxyribonucleotide and is made up of nitrogenous base, sugar and phosphate.

Q: Results: Table below showing the antibiotic susceptibility of E. coli Antibiotic Observed zone of…

A: Microbial antibiotic susceptibility refers to the degree to which a particular microbe (such as…

Q: Write a sentence (minimum of 5 sentences, maximum of 8) about Covid-19 with an argumentative…

A: 1):- covid -19 is an infectious disease caused by the newly discovered coronavirus.it was first…

Q: Each _________________- chromosome contains (prior to itsreplication) a single molecule of linear,…

A: during nuclear division, the nuclear material which is the chromatids double in number. they…

Q: Use at least three anatomical terms to describe the location of the star on the figure below. Answer…

A: Anatomical terminology are used to define particular body parts, movements, and relationships to one…

Q: Paragraph Styles Edit Deafness in Cocker Spaniels is inherited. The allele for deafness is recessive…

A: It is given that deafness is a recessive trait and given by d while normal hearing is dominant given…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: you did not provided the whole worksheet

A: Asexual reproduction involves only a single parent while sexual reproduction involves two parents as…

Q: Solve simple questions

A: The first step DNA replication involves the unzipping of DNA molecule's double helix structure .…

Q: Translate the following mRNA. Use the space for your answer.…

A: Translation  The process of converting nucleic acid information into amino acids. It is also relates…

Q: 6. Recently, athletes have begun to take advantage of the benefits of extra red blood cells, in a…

A: Introduction : A hematocrit is a straightforward blood test that measures the proportion of red…

Q: Ellen Armstrong, CMAS (AMT), administrative medical assistant at Inner City Health Care, has been…

A: Liz Corbin should be initially subjected to the training of the numeric patient data filling method…

Q: Please answer fast A scientist used the identifiler PCR kit on a sample from crime scene. He got…

A: Forensic Scientist got no amplification in case of negative control here. So, the PCR stock is good…

Q: Can you please check my answer and make sure it is correct.    Question: How can DNA evidence be…

A: DNA can be used to identify criminals with incredible accuracy when biological evidence exists. They…

Q: RL/rl × rl/rl do the punnett square for this cross

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Align the following sequences and determine the percent identity: AVILLVLGWSRKA…

A: In the realm of sequence analysis, a fundamental aspect is the alignment of genetic or protein…

Q: Contrast what is happening in the heart when you hear a lup with what is happening in your heart…

A: Ans. The muscular organ that pumps blood throughout the whole body is the heart. The blood that is…

Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…

A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…

Q: write about cytochrome p3A4 enzyme .

A: Cytochromes are the enzymes that contains heme as a cofactor. They helps in oxidizing steroids and…

Q: Why does the genus Streptomyces of the Actinobacteria clade secrete chemicals (antibiotics) that can…

A: Streptomyces is the largest genus of the Actinomycetota and the type genus of the family…

Q: If a pregnant woman had a karyotype prepared for her baby before birth, would it be more useful in…

A: A individuals complete set of chromosomes is known as karyotype.

Q: The left side has to be matched to the right side.

A: Amoebozoa is a protist group of around 2,400 species of amoeba. Opisthokonta is a eukaryotic group…

Q: answers above are partially correct, but more are missing. im confused on which one of the others…

A: Introduction Adenosine 5′-triphosphate (ATP) is a key "energy molecule" found in all living things.…

Q: discuss the terms genetically modified and transgenic in your own words.

A: * Genetically modified means genetic material either DNA or RNA of an organism has been artificially…

Q: A ______________ mutation results from exposure to toxic chemicals (mutagens).

A:

Q: please label the parts. use arrow to edit on pics to locate the parts (especially the stem)

A: The purpose of flowers is sexual reproduction, subsequently guaranteeing the endurance of the…

Q: Each of us is genetically unique. Describe two processes that ensure that your future full sibling…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: ______________________________________________________________ 1. People who carry a theoretical…

A: Restriction fragment length polymorphism or RFLP is the easiest way to detect the presence of SNPs…

Q: Please help urgently with the complete answer of this question asap

A: Proteins are biomolecules are made of amino acid monomers. Amino acids are joined together by…

Q: 1. Define each term listed as the Nursing Diagnosis Qualifier (NDQ). 2. Provide three (3) Nursing…

A: As a nurse, understanding Nursing Diagnosis Qualifiers (NDQ) and their associated Nursing Diagnosis…

Q: Suppose two men could be the father of a child. Before doing an expensive paternity test, the…

A: The answer is YES. The only way for the child to be O-type would be if he received an O allele from…

Q: Pregnant women often experience numbness in their fingers and toes. Why? Please, answer on your own…

A: Tingling, numbness, and pain in the hands are common during pregnancy, especially in the last…

Q: Describe the functions of various enzymes involved in DNA replication.

A: A complex process that occurs during the cell cycle's S phase, where copies of DNA are synthesized…

Q: What is the chemical nature of the enzyme primase?

A: Primase Enzyme is also known as DNA Primase. These are essential for the replication fork of DNA and…

Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.

A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…

Q: please help me find the answer

A: The given figure shows the chemical structure of a compound. A chemical structure is defined as an…

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.