Please help urgently with the complete answer of this question asap
Q: Please I need help understanding this question
A: Digestive system is part of body system that play chief role in the breaking up of food material…
Q: Except for the following státements about blood are true.
A: Blood is the main circulatory fluid in our body. Functions of blood:- 1)To carry oxygen from the…
Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…
A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…
Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…
A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…
Q: During which phase of cardiac cycle, the blood enters pulmonary trunk? Ventricular systole
A: Heart is a muscular organ that is present in front and middle of the chest, just behind and slightly…
Q: Please help urgently with this question please?
A: Actin is a globular protein that forms microfilaments, a type of cytoskeleton present inside most of…
Q: The following describes a hormone cascade. Put these steps in the correct order by matching the…
A: The human endocrine system comprises a series of specialized glands that are responsible for…
Q: A new mutation in Saccharomyces cerevisiae, a eukaryotic yeast, causes the cells to be unable to…
A: Saccharomyces cerevisiae is a type of Yeast that has the ability to ferment sugar into carbon…
Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT…
A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of…
Q: Punnett Square a What is the percent chance the offspring will be green? 0% Gg 100% 99 25% Privacy…
A: A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various…
Q: Please I need help understanding this question
A: RBCs or red blood cells are also known as erythrocytes, red cells, or red blood corpuscles. They…
Q: 3. What is the difference between cytoplasmic determinants and induction?
A: Cytoplasmic determinant plays an important role during oocyte maturation. The asymmetric…
Q: Refer to the accompanying figure. In which part of the muscle fiber are calcium ions stored?
A: Muscle tissue contains something called muscle fibers. Muscle fibers consist of a single muscle…
Q: 1. Cross a person with heterozygous type B blood with a person with type AB blood. List the…
A: 1. Blood is a circulating biological fluid in the body composed of blood cells and plasma.…
Q: 40 no/ little 40 40 30 no ste Life Stress 20 20 20 Life Stress a lot 10- VI Genotype Does the data…
A: The genotype is the genetic characteristics of an organism and phenotype refers to the physical…
Q: Chapter 16 The Endocrine System 17 dict It: Hormones and Homeostasis Predict the hormonal response…
A: Hormones are chemical messengers that are secreted from the ducts in the body. They may function at…
Q: Which procedure should have been performed to prevent error in this investigation?
A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…
Q: Organ Lymph nodes Tonsils 4. Thymus along the course of the lymphatic vessels 2. 5. 6. Location…
A: As per Bartleby guidelines, an expert cannot answer more questions at a time. So, kindly post other…
Q: oli. The scientists measured cell size in a dom sample of individuals (each dot) at th ginning of…
A: Escherichia coli, additionally referred to as E. coli, may be a gram-negative, facultative…
Q: also contract with the rest of the cells in the heart wall. are special neurons that convey signals…
A: Sinu atrial nodes are specialised myocardial structures located in the right Atrium which causes the…
Q: The Kingdom Protista is initially divided into two groups based on whether the organism in question…
A: 5 kingdom classifications is a type of classification in which living organisms are classified into…
Q: 3) Whole-mount in situ hybridization can be used to test for the function of non-coding DNA region.…
A: * Whole mount in situ hybridization is a tool that aids for temporal and spatial dissection of gene…
Q: I’m having hard time grasping the question can you please help answer this question?
A: Ash is a huge reservoir of nutrients. It acts as an additional factor in fastening the growth of…
Q: Functions of the large intestine include O reabsorption of water and compaction of feces. most of…
A: The digestive system help in the break down of the food substances into the body. This system has…
Q: 5. You have performed the following serial dilutions: 1:100, 1:100, 1:10. Diagram this dilutie…
A: Formula used : CFU/mL = observed CFU / Volume to be analysed X Dilution factor
Q: Please help me with this question within an hour immediately with complete answer
A: Please Post Questions Separately.
Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: I am not sure how to answer this question
A: Red/green colorblindness is an X-linked recessive trait. Let’s represent the normal allele by X and…
Q: Please I need help understanding this question
A: Blood is the fluid connective tissue of the body. the blood contains several types of cells as well…
Q: We conducted computer simulations under two different scenarios, shown in the two figures below.…
A: The figure is showing in scenario 1 that the allele frequency of A1 is consistently fluctuating, so…
Q: Which chamber(s) will be contracting right after this élēctrical event (in red) T S/ O right atrium…
A: The heart is the pump that works rhythmically to pump oxygenated blood to all parts of the body and…
Q: Which of the following is a result of agriculture? Sedentarism Nomadism Egalitarianism Foraging
A: To determine: To determine the result of agriculture from the given options
Q: All the following is true of CO poisoning éxcépt CO is an odorless gas O CO has higher affinity to…
A: Carbon Monoxide when breathed binds to the haemoglobin so strongly that it doesn't let oxygen bind…
Q: Blood is supplied to the myocardium by O contact with blood in the pumping chambers. O the coronary…
A: The heart is the main organ of the circulatory system of the body that is responsible for pumping…
Q: а ТЕМ.
A: cell biologist or researchers are examine cells and magnify organelles and track cells as they…
Q: Starting appear in squalene. 14 H3C COA 5.) Starting with the following radiolabeled acetyl-CoA map…
A: Introduction: Biosynthesis of cholesterol occurs from the acetyl-CoA in four stages.
Q: Please help me this question ASAP need to submit urgently
A: Answer is option b.) double stranded , circular DNA molecule.
Q: Excess fluid in the cavity can make it difficult for heart to have an efficient diastole.…
A: Heart beats in a cyclic pattern and this pattern is known as cardiac cycle. It has two phases,…
Q: Once a protein's life span in a eukaryotic cell has hit its limit, how does the cell respond?
A: A cell spends the majority of its time in interphase, which is when it develops, replicates its…
Q: Please I need help understanding this question
A: Protein is an amino acid-based macromolecule that plays a crucial role in the body. Carbon,…
Q: Which of the following steps DOES NOT require ATP? A. The preparatory phase of glycolysis В.…
A: ATP or Adenosine triphosphate is the basic energy currency of the cell which is the end product of…
Q: you SE the target ratio of phage to bacteria is 0.1 a pfu/cfu. The bacteria are at a concentration…
A: Option b 2* 104 and o.1ml
Q: The second heart sound ("dupp") is associated with closure of 3 1. 4 O 1 & 2 O 1 & 3 O 1 & 4 2.
A: Human Heart is chief beating structure exhibited in the Thoracic cavity . Impure blood from all…
Q: -35. This factor that could cause the diversity in the gene pool on Earth to change is called A.…
A: As per our policy, we are answering the first question only. (question 35) For the rest of the…
Q: After solving the crystal structure of a novel enzyme and looking at the active site, a researcher…
A: The catalytic efficiency is the measure of how the enzyme works when substrate concentration is low.
Q: Please I need help understanding this question
A: Blood is basically a connective tissue in fluid form. It is called the fluid of life as it carries…
Q: Two lefties marry. What percent of their offspring can be expected to be left-handed?…
A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…
Step by step
Solved in 3 steps
- For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGCompute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTAbased on the pictures How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
- e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAACompute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGT
- For the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.based on the picture What is the length in basepairs of these sequences? How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)