The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in these experiments?
Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…
A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…
Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…
A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…
Q: How many codons would be possible in a triplet code if only three bases (A, C, and U) were used?
A: Codons are the sequences of DNA or RNA containing three nucleotides in a single set that codes for…
Q: What is the role of 5' end of RNA transcript in eukaryotes during initiation of translation?…
A: Throughout transcription, the 5' cap is inserted to the transcript's first nucleotide. The cap is an…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: In this chapter, we considered a computer program that translates aDNA sequence into a polypeptide…
A: Translation is a process in which the conversion of DNA sequence into amino acid sequence takes…
Q: If there are multiple start condo, how can you identify the real start codon? By observing Okazaki…
A: Transcription and translation are specialized events that are part of the central dogma i.e. DNA to…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…
A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…
Q: What is the difference between transcription and translation during the central dogma of molecular…
A: The gene expression is divided by mainly two steps that are transcription and translation. Together…
Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…
A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…
Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…
A: Option b
Q: Why would translation not work if ribosomes could bind only one tRNA at a time?
A: According to the central dogma of the molecular theory, the information stored in the DNA is first…
Q: Please describe the four-step process of the elongation during protein translation in bacteria.
A: Translation is the process of formation of proteins from mRNA with the help of ribosomes in the…
Q: You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA.…
A: mRNA is the messenger ribonucleic acid that is produced by the process of transcription. The RNA…
Q: Explain the steps of Eukaryotic Translation Initiation. 1. Formation of preinitiation complex. 2.…
A:
Q: What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61…
A: A transfer RNA is adaptor molecule composed of RNA having 76 to 90 nucleotides in length.
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: Splicing The removal of introns (non coding part of gene) from pre mature RNA.
Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…
A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…
Q: why is GTP hydrolysed in translation termination in bacteria? What are the by-products of…
A: The translation termination occurs when the stop codons are placed near the A site. These include…
Q: Know the name of the RNA molecule that is the initial product of the transcription of a eukaryotic…
A:
Q: What would be the consequences if a mutation removed the rut site from this RNA molecule?
A: Mutation is an abrupt change in the DNA sequence and nucleotide base pairs. Mutation is caused by…
Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…
A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…
Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…
Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…
A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…
Q: Give the anti-codon of this Trna?
A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…
Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…
A: Transcription is a process in which one strand of DNA known as template strand is known as converted…
Q: The E site may not require codon recognition. Why?
A: The translation is the process, during which protein is synthesized from mRNA sequence. The mRNA…
Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…
A: Alternative splicing is a method through which a messenger RNA may control the creation of many…
Q: What would happen if an intron wasn't taken out before translation? And are there
A: DNA contains many sequences such as promoters, introns and exons. Some sequences in DNA are supposed…
Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…
A:
Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?
A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…
Q: In a coding experiment using repeating copolymers , the following data were obtained: Copolymer…
A: Genes are the unit of hereditary that carries all essential information of life. They are present in…
Q: Why do scientists now believe that AUG is not always the start codon?
A: The start codon is the codon that is translated first for a mRNA transcript. Usually, the most…
Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron…
A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription…
Q: Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the…
A: The genetic code may be defined as the exact sequence of DNA nucleotides read as three letter words…
Q: Why is wobble tolerated in the third position of the codon but not in the first two?
A: Deoxyribonucleic acid(DNA) carries genetic information required for the survival of living organisms…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…
Q: It was assumed that RNA was the first genetic material, and RNA can encode proteins that act as…
A: Introduction Oparin-Haldane model demonstrated the chemical evolution and suggested that inorganic…
Q: Exceptions to the universality of the genetic code were once thought to be rare, but more and more…
A: The genetic code consists of a triplet code, in which three nucleotides encode a single amino acid…
Q: For each of the following initiation factors, how would eukaryotic initiation of translation be…
A: The process of translation is characterized by the formation of the polypeptide or the proteins from…
Q: You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located…
A: Transcription is copy of genetic information from DNA to RNA. Eukaryotic transcription is more…
Q: What amino acid is coded by the original sequence (GTA) if the sequence refers to the template…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…
A: The proteins are the fundamental biomolecules in the body and act as substrates, enzymes, and…
Q: How does placement of a ribosome at the start codon differ in bacteria and eukaryotes? What role do…
A: Bacteria are prokaryotic organisms with metabolic machinery different from the eukaryotes.
Q: Briefly, describe one mode of post-translational modification that occurs once translation is…
A: Following protein biosynthesis, post-translational modification refers to the covalent and usually…
Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…
A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in these experiments?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)
- Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codonSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.
- The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-LysPhenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and UAU. Given this, and given what you know about tRNA selection, will Phenylalanine be found in the resulting polypeptides? (Assume translation will happen even without a start codon; Also this is a bit tricky, so review the contents of the assay before answering.) Yes, in part because phenylalanine is also coded for by UUU Yes, because ribosomes select the amino acid regardless of the anticodon sequence Yes, for both of the reasons listed above. No, because it is no longer attached to the tRNA with the GAA anticodonSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal