The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The DNA sequence of one strand of a gene from three
independently isolated mutants is given here (5′ ends
are at left). Using this information, what is the sequence of the wild-type gene in this region?
mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG
mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG
mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
