The built-in function eval takes a string and evaluates it using the Python interpreter. For example: >>> eval('1 + 2 * 3') 7 >>> import math >>> eval('math.sqrt(5)') 2.2360679774997898 >>> eval('type(math.pi)') Write a function called eval_loop that iteratively prompts the user, takes the resulting input and evaluates it using eval, and prints the result. It should continue until the user enters 'done', and then return the value of the last expression it evaluated.

The built-in function eval takes a string and evaluates it using the Python interpreter. For example: >>> eval('1 + 2 * 3') 7 >>> import math >>> eval('math.sqrt(5)') 2.2360679774997898 >>> eval('type(math.pi)') Write a function called eval_loop that iteratively prompts the user, takes the resulting input and evaluates it using eval, and prints the result. It should continue until the user enters 'done', and then return the value of the last expression it evaluated.

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter15: Recursion

Section: Chapter Questions

Problem 12PE

See similar textbooks

Related questions

Q: Implement the following function. - Code should be in Python: Morse Code: code = { 'A': '.-',…

A: Python program to convert string to Morse-code and vise-versa (Morse-code to string)

Q: remove_substring_from_string(s, substr): This function takes two strings s and substr as input. It…

A: PROGRAM CODE: # start definition of function to remove substringdef remove_substring_from_string(s,…

Q: Write a program in C++ that lets the user enter the total rainfall for each of 12 months into an…

A: #include <iostream> using namespace std; int main(){ double a; double sum=0;…

Q: 3. String (a) Write a Python function that accepts a string s and an integer n with a single digit…

A: In this exercise, we will create two Python functions to manipulate strings. The first function,…

Q: 3 9 10 11 12 det verity(number): # do not change this line! # write your code here so that it…

A: Below is the code:

Q: Mr. X is a student of Computer Science. He is facing a problem and needs your help to solve it. The…

A: We will use an array to hold the user input integers. An array is a data structure that holds…

Q: please code in python Write a function that receives a string and a number (n) as parameters and…

A: To implement everyNth(), strings concept in python is used.

Q: Python Returning Funtion function name: bound_0_to_100 parameters:a number grade returns: the grade…

A: Pseudocode: Define a function named bound_0_to_100 having grade as its parameter If the grade is…

Q: Python Functions for Statistical Applications 1A. Implementation with the standard def keyword…

A: SOLUTION - 1A. Implementation with the standard def keyword Here is the correct 1 line for the…

Q: 1) Store the following data into a tuple, colors: red, green, 2) Store the following data into a…

A: colors=("red","green"); shapes=["rectangle","circle"]; #if there is no spacingprint("colors:…

Q: Create a grading program in C as follows. - Ask the user for the number of students and store it in…

A: Algorithm for Grading Program in C1. Start2. Declare variables:numStudents (integer) to store the…

Q: In C++ Find the five errors. For each error, state the line number, explain the error and show a…

A: Answer:)

Q: Guess a letter: w wallaby You win! # The program selects the word platypus Guess a letter: b…

A: The given python code is examined and the respective needed changes are done on the given code and…

Q: Question 9 Write in Python! Write a function word count that will take a sentence (string) and…

A: Code is attached in step 2 along with screenshot

Q: Write a function in Java that implements the following logic: Given a number n, return true if n is…

A: I have provided JAVA CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT---------

Q: Exercise Objectives Problem Description Write a program that reads a string and mirrors it around…

A: Write a program that reads a string and mirrors it around the middle character. abcd becomes cdab…

Q: python question: Write a code that takes a sentence as an argument and places its words in a list…

A: #method that takes sentence as argument and places its words#in a list in alphabetical order and…

Q: python3 Write a recursive function called is_palindrome(string) that takes a string parameter and…

A: I have provided PYTHON CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT------------

Q: 1- Write a function that takes a word less than 25 characters long and returns the letter that word…

A: To find the capital letter of a word, we can test it against the ASCII values. We know that the…

Q: Scrabble Scrabble is a game where players get points by spelling words. Words are scored by adding…

A: Hello student Greetings Hope you are doing great. Thank You!!!

Q: an array of floats with four rows and columns equal to the number of students stored earlier. -…

A: Before diving into the code, let's set some foundational knowledge:Arrays: A collection of items…

Q: Here is a function that is supposed to return True if word (any string) ends with "s" and False…

A: The condition mentioned in definition is for only small ‘s’ . You need to use or for capital ‘S’…

Q: *in Python The built-in function eval takes a string and evaluates it using the Python interpreter.…

A: Writing function called eval_loop that iteratively prompt the user, takes the resulting input and…

Q: Write a python program with two functions/modules that does the following: .main() accepts input and…

A: Algorithm: Define a function called 'num_Test()' that takes an input string as its argument. Within…

Q: Description - this is a recursive function that prints the string repeatedly. Each time it prints…

A: #include<stdio.h>#include<string.h> #define STR_MAX_SIZE 100 void preserveString(char*,…

Concept explainers

Declaring and Defining the function

A set of statements, which performs a particular task is called a function. The program gains modularity by using function. The application is quite easy to understand, read, and edit when they are created with functions. The developer/programmer creates a function and uses main() to call the function. Once the function gets executed, the control is transferred to the main program.

Question

Exercise 2

The built-in function eval takes a string and evaluates it using the Python interpreter. For example:

>>> eval('1 + 2 * 3') 7 >>> import math >>> eval('math.sqrt(5)') 2.2360679774997898 >>> eval('type(math.pi)') <class 'float'>

Write a function called eval_loop that iteratively prompts the user, takes the resulting input and evaluates it using eval, and prints the result.

It should continue until the user enters 'done', and then return the value of the last expression it evaluated.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Define Python.

VIEW

Step 2: Required function

VIEW

Solution

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

JAVA CODE ONLY AND PROVIDE OUTPUT SCREENSHOT PLEASE
Exponent y Catherine Arellano mplement a recursive function that returns he exponent given the base and the result. for example, if the base is 2 and the result is 3, then the output should be 3 because the exponent needed for 2 to become 8 is 3 (i.e. 23 = 8) nstructions: 1. In the code editor, you are provided with a main() function that asks the user for two integer inputs: 1. The first integer is the base 2. The second integer is the result 2. Furthermore, you are provided with the getExponent() function. The details of this function are the following: 1. Return type - int 2. Name - getExponent 3. Parameters 1. int - base 2. int - result 4. Description - this recursive function returns the exponent 5. Your task is to add the base case and the general case so it will work Score: 0/5 Overview 1080 main.c exponent.h 1 #include 2 #include "exponent.h" 3 int main(void) { 4 int base, result; 5 6 printf("Enter the base: "); scanf("%d", &base); 7 8 9 printf("Enter the result: ");…
About beginner python programming: - Make a function in Python called SIGA, which receives a tuple containing 4 pieces of information: the nameof the student and his three respective grades. Your function should return a tuple, whose first element is the student's name,the second element is the grades average, and the third element is the student's situation, which must be representedby a string. If the average of the three grades of the student is greater than or equal to 7 (inclusive), the function should bereturn: (<name>, <average>,’approved’, ’Congratulations!́). If the student's average grades is less than 7 but greater than or equal to 5, your function should return: (<name>, <average>,’approved’). If the average is smallerthan 5, the function should return (<name>, <media>,’failed’). This function should return the averagewith one decimal place only.
C++ printSmaller is a function that accepts two int parameters and returns no value. It will print the value of the smaller one parameters. The function protoype is as follows: void printSmaller(int num1, int num2); write the statments to read two integers and call this function to display the smaller one.
Functions With Parameters and No Return Values Quiz by CodeChum Admin Create a program that accepts an integer N, and pass it to the function generatePattern. generatePattern() function which has the following description: Return type - void Parameter - integer n This function prints a right triangular pattern of letter 'T' based on the value of n. The top of the triangle starts with 1 and increments by one down on the next line until the integer n. For each row of in printing the right triangle, print "T" for n times. In the main function, call the generatePattern() function. Input 1. One line containing an integer Output Enter·N:·4 T TT TTT TTTT
solve in c language
In C++ Find the five errors. For each error, state the line number, explain the error and show a correction. #include<iostream> #include<iomanip> using namespace std; class colorCode { public: void setRGB(int); //accepts an int parameter and sets the RGB to the value of the parameter void setName(string);//accepts a string parameter and sets the name of the object to the value of the parameter string getName() const;//returns the name of the object int getRGB() const;//returns the RGB of the object void changeColor();// adds 10 to the RGB value private: string name; int RGB; } int main() { colorCode paintCans[10]; int i; for (i = 0; i < 10; i++){ paintCans.setRGB[i] = 0;} paintCans[5].setName(GREEN); paintCan[5].setRGB(192000); cout << paintCans[5].getName << ' ' << paintCans[5].getRGB() << endl; return 0; }
Functions- Write a C++ function that takes an integer argument, say n, and prints hello n times.
Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.
Write a function that takes a sentence and returns its inverse.Char* Reverse(char*)String: “Hello World How Are You”After calling Reverse Function String: “You Are How World Hello” (Do not change the original string or built-in functions) C language
C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…
Write python codes