The axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation. axial ratio: x10

Q: One gram of cultured human cells contains about 109 cells and occupies roughly 1 mL. If the average…

A: Deoxyribonucleic acid (abbreviated DNA) is the molecule that carries genetic information for an…

Q: Answer for 1 ,2,and 3  asap

A: Answer given in steps 2 onwards. Please find the attachment. Thank you

Q: The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words,…

A: The size of a genome varies depending on the complexity of the genomes of different species.

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: Can you please help with 1d please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: Binturong or the bearcat is found in South and Southeast Asia. It is declared as vulnerable,…

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…

A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…

Q: A diploid organism with a 45,000-kb haploid genome contains 21% G residues. Calculate the number of…

A: According to Chargaff's rules, DNA from each cell of any organism should contain a 1:1 ratio (base…

Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…

A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: The SNP is single-nucleotide polymorphism is a variation of DNA sequence that occurs when single…

Q: Calculate the number of clones required to obtain with a probability of 0.99 a specifi c 5-kb…

A: A random collection of DNA fragments , typically representing the entire genome of an organism  that…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: As in the question, the sequence of DNA template is :3'- TAC TGG CCG TTA GTT GAT ATA ACT -5' Then,…

Q: You dilute 10 µL of your isolated DNA with 90 µL of water. You then measure and record the…

A: To calculate the concentration of the plasmid DNA in μg/mL, we can use the following…

Q: Consider the following coding sequence transcribed from 5' to 3' 5' A T G A A G C G C T C A G T A 3'…

A: Substitution of guanine at position 11 would result in to conversion of UCA into UGA (which is a…

Q: See the attachment and answer the following parts of the question: A) If the binturong genome is…

A: Binturong is a eukaryote in which there is highly repetitive DNA sequence is present. The copies of…

Q: The chromosome of the bacterium (prokaryote) Escherichia coli has a size of approximately 4,000…

A: DNA stands for deoxyribonucleic acid. It carries genetic information useful for development and…

Q: 5'- CTC GAG CGA AG was obtained as a dry solid. The sample was dissolved in 1000 ul of deionized…

A: Deoxyribonucleic acid (DNA) is a complex organic molecule found in all prokaryotic and eukaryotic…

Q: --TGT(G/C)CAG------3'

A: SNV means single nucleotide variants on individual RNA molecules To identify genomic differences we…

Q: Identify the leading and lagging strands for each (A through D) in the figure below. origin A 5' 3'…

A:

Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…

A: Note:  As per the guidelines, the first question has been solved here. Please post the other…

Q: The figure shows that the average distance between base pairs measured parallel to the axis of a DNA…

A: DNA is composed of 2 polynucleotide strands would in a helical manner. Distance between 2 base pairs…

Q: please solve this with step-by-step calculations and explanations.

A: Here is handwritten answer

Q: Rice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?

A: In a double helical DNA, there are 4 nucleotides are found ATP, GTP, CTP, TTP. In this double…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all…

A: Note that in determining the complementary of a DNA sequence, always remember that adenine (A) pairs…

Q: Give typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing…

A: DNA sequencing is a technique that involves reading the order of the arrangement of DNA bases. Maxam…

Q: The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the…

A: Here, first we have to calculate the RNA units that will be used for peptide synthesis  so, 60% 0f…

Q: The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence…

A: Introduction  DNA denaturation, sometimes called DNA denaturing, is the conversion of…

Q: In hybridizing microarrays, we use a solution that contains {3X SSC, 0.5% SDS, 5ug/ml salmon sperm…

A: The ratio of mass of solute present in a solution relative to the volume of the solution represents…

Q: The Tm of a DNA strand can be calculated by hand using the formula:           (2 ℃)(?????? ?? ? +…

A: Two standard approximation calculations are used. For sequences less than fourteen nucleotides the…

Q: What do you mean by amphoteric substance? Give examples of substance that is/are amphoteric. What is…

A: Answer 1. An amphoteric substance is a chemical species that, depending on reaction conditions, can…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: a. Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…

A: DNA replication helps DNA to double itself.

Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…

A: A separation technique known as electrophoresis relies on the movement of charged species in a…

Q: A sample of chromatin was partially digested by the enzyme Staphylococcal nuclease. The DNA…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Introduction  The DNA/gene give rise to the formation of mRNA by the process called gene…

Q: Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models. Do you expect the same values for…

A: Adenine (A) pairs with Thymine (T): Adenine (A) always forms hydrogen bonds with thymine (T) in…

Q: If the length of E. coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coli?

A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.