Stream 1 Taxon #individuals (n) | n-1 n(n-1) 1 75 234 9 56 4 5 1 ΣΝ Σn(n-1)

age of the individual  sex of the individual  hieght of the individual

tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter

Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent genes, the "-" represents the centromere of each chromosome, and chromosomes are shown on separate lines. ABCDE-FGHIJK 123-45678 Identify the type of rearrangement shown in each of the following (A-C) and then identify whether it is balanced or unbalanced. Assume that the individual is diploid and heterozygous for the rearrangement. A. • ABCDE-FGHIJKGH 123-45678 Rearrangement: [Select] • Balanced or Unbalanced: [Select] B. • ABCDGF-EHIJK 123-45678 Rearrangement ✓ [Select] • Balanced or Un pericentric inversion Robertsonian translocation deletion tandem duplicate paracentric inversion C. reciprocal translocation ABCDE dispersed duplicate nonreciprocal translocation 123-45

* Le TH Sa u GWG AA PE x GWB Bi 31 K S. .com/forms/d/e/1FAlpQLSeRQOhizlj9haFIAG8XZwqYqNjd4lzDAumrUT8-Azr5lcf77g/viewform?hr_ submission=Chkl14ORirMBEhA e A 33rd Period 10th Gr... Maps H Mail - SC458917 -.. A 33rd Period 10th Gr.. E Applied Educationa.. A To-do A researcher uses a logistic model of population growth. Which statement best describes the relationship between time and population size in a logistic growth model? Over time, population size increases without limit. Over time, population size increases and then levels off to a maximum value. Over time, population size decreases and then levels off to a minimum value. Population size is not related to the passage of time. As limiting factors, how do disease differ from a forest fires? thing 1O DELL

Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr  - do it on this format

5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 --+---- 70 3′-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTCACATTACAAACGGATTCCGG -5' 1 11 -#- -+-- +-- a) Draw a green box around the promoter. b) Label the template strand of the DNA on the sequence above. --+-- -+ c) Write the sequence of the pre-mRNA. d) This gene has a small intron and the intron splice sites has the composition 5'-GUG-3' (for the 5' splice site) and 5'-UUG-3' (for the 3' splice site), meaning that these sequences and everything between them will be removed from the mature mRNA. -Draw a box around the intron on the DNA sequence above. e) Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. f) Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?

Second letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…

936/variants/3043936/take/12/ Use at least three anatomical terms to describe the location of the star on the figure below. Answer using 1 to 3 complete sentences. ooooo estions Answered O t UN All Changes Saved < Q

Can you match these prefixes, suffixes, and word roots with their definitions? trans- inter- chrom- -some (or soma-) bi- aqu- (or aqua-) -elle water: between: color: body: across: little, small: two: Reset Help