Q: If dogs became self-domesticated through a commensal relationship with modern humans, which of the…
A: Answer :: Symbiotic- A symbiosis is an evolved interaction or close living relationship between…
Q: Which of the following nutrients is critical for a toddler's nervous systems development? A. Sugar…
A: The formation of your baby's brain is a complicated process that occurs throughout your pregnancy.…
Q: 7. The vascular tissue that transports water and minerals from the soil to the rest of the plant is…
A: The cell cycle is a four-stage process in which the cell increases in size (gap 1, or G1, stage),…
Q: docs.google.com/forms/d/e/1FAlpQLSfcb08kSEoX2nkHlw2TQntW-IHbohTvMGsXQmKO36VumnFnEQ/formResponse How…
A: Introduction :- The oval window, also known as the fenestra ovalis, is a connective tissue membrane…
Q: Name four differences between the structure of DNA and RNA.
A: Introduction :- Ribonucleic acid (RNA) is a nucleic acid found in all living cells that is…
Q: a- Fadi woke up late and did not have time to ate his breakfast. After leaving his house, his…
A: a) Parasympathetic nervous system This division of the nervous system is responsible for maintaining…
Q: Which statements are true? Explain why or why not.1 Each member of the human hemoglobin genefamily,…
A: The statements are well analysed and the answers are given below.
Q: The accoumulation of higher levels of mercury in large predatory fish is a result of? A. Genetic…
A: Biomagnification is the buildup of a chemical by an animal as a consequence of water and food…
Q: Zero order kinetics refers to: A Rate is dependent of concentration or amount of chemical B Rate of…
A: 1. Zero-order absorption occurs when a substance is taken at a nearly constant rate. A fixed amount…
Q: In the SIR equation for Infectious hosts, why is the term "- vl" negative?
A: The SIR equation is a mathematical model to study epidemics. Consider the system below. S →β[S][I] I…
Q: The transphosphorylation of STAT proteins by Jannus Kinase causes: a. formation of STAT heterodimers…
A: Solution - c is correct option- formation of stat heterodimer which act as transcription factor.
Q: Select the statement that apply to the bottleneck effect: 5 correct answers
A: In a population bottleneck, the residual population is subjected to increased genetic drift, which…
Q: Why is flexibility the most neglected component of health-related fitness?
A: The bulk of citizens, even those who place a high priority on other aspects of fitness, prefer to…
Q: The 20th century would witness the new anti-biotic revolution that would save millions of lives.…
A: Antibiotics, also called antibacterials, are drugs that kill or slow the growth of germs. They…
Q: Contrast positive versus negative regulation of gene expression. Describe the role of the repressor…
A: Positive and negative control of gene expression In some cases, the product of a regulatory gene is…
Q: Ir Semitend Sem eanoeus
A: Answer pig bones labelling
Q: Unilateral Cerebral strokes can cause deficits in motor control, somatic sensation and vision.…
A: Anterior circulation stroke typically causes unilateral symptoms. Posterior circulation stroke can…
Q: Compare the control of gene regulation in eukaryotes and prokaryotes in terms of: a. transcription…
A: Prokaryotes and eukaryotes change their Gene articulation with respect to their environmental…
Q: Discuss the 3 laws of thermodynamics and apply it on the ecosystem.
A: The 3 laws of thermodynamics are - 1st Law of Thermodynamics - Energy cannot be created or…
Q: Q6. Based on the data in the table below, which of the following pairs of species are likely to be…
A: The timan's model of resource compilation is a theory in community ecology that endeavors to…
Q: part i How many of the following are characteristics of arthropods? 1. protostome development…
A: Characteristics of arthropods (Correct options): Option 2: Arthropods are bilaterally symmetrical.…
Q: Identify and label these parts in old woody dicot roots: Cork Vascular cambium Cork cambium…
A:
Q: Concerns with the resident microflora of the Gl tract and certain toxicants include A Microflora are…
A: 18. The most essential enzymes engaged in the phase I metabolism of medicines and toxins in…
Q: What are the stages into which photosynthesis is divided?
A: Introduction - Photosynthesis is a cycle utilized by plants and different life forms to change over…
Q: 18.During ejaculation, sperm cells and semen is released from the reproductive tract of a male. What…
A: Introduction :- In sexual reproduction, sperm is the male reproductive cell, or gamete. Animals…
Q: If you discovered a fossil hominin that was adapted for both arboreal and bipedal locomotion, had an…
A: Introduction Bipedalism is a type of terrestrial locomotion in which an organism moves by using its…
Q: Which of the following is a Phase II reaction? A Dehalogenation B Reduction c) Oxidation Glutathione…
A: ANSWER;-D) Glutathione conjugation. Explain;- Phase II reactions consist of adding hydrophilic…
Q: Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences,…
A: Answer :: Introduction A plasmid is a genetic structure in a cell that can replicate independently…
Q: In a genetic system of complete dominance, a recessive allele is expressed Select one: A.…
A:
Q: B) Large scale clinical trials infecting human with pig whipworm were halted because those in…
A: Worm therapy is a kind of alternative treatment which has been searched in order to fight from…
Q: Your patient has been poisoned by an unknown substance and shows signs of delirium, abnormal heart…
A: Introduction When an organism is exposed to a sufficient amount of poison, it can cause death,…
Q: 2.If you were running an experiment and interrupted the interaction between thin and thick…
A: Introduction :- When a sarcomere (a) contracts, the Z lines become closer together and the I band…
Q: 13.Which of the following statements is TRUE about corpus luteum?(This is a multiple choice question…
A: Answer--
Q: Label the visible parts of mung bean and corn seedlings
A: The embryo, endosperm, and seed coat are the three main components of a seed. Before it develops…
Q: .Place the following events of the acrosomal reaction in the correct chronological order. (1) The…
A: The acrosome response is the acrosome's exocytosis, or the fusing of the acrosomal membrane with the…
Q: Antiobiotics should be taken if your child catches a seasonal flu cause by virus? A. True B. False
A: Introduction :- an infective agent that typically consists of a nucleic acid molecule in a protein…
Q: Fadi was diagnosed of having chronic stress due the bad economic and political situations in…
A: The common cold is caused by viral infection. People under severe stress are more likely to catch a…
Q: 1. penetrates deep into the tissue, but without the subjective sensation of heat and burning of the…
A: Infrared radiation is emitted from the sun and fire and radiation can be sensed as a warm feeling on…
Q: Each enzyme is able to promote only one type of chemical reaction. The compounds on which the enzyme…
A: Enzymes are the proteinaceous molecules which when added to reaction enhances the activity .…
Q: The amount of glycogen stored in muscles is enough for hours' exercise? A. True B. False
A: Our cells' primary fuel source is glucose. When the body does not need glucose to function, it…
Q: Which of the following factors in today’s world make it dif-ficult to keep disease-causing…
A: Diseases can be infectious diseases, hereditary diseases, deficiency diseases, and physiological…
Q: There are 10 E. coli cells in a test tube. After 4 generations in exponential phase, how many E.…
A: A growing bacterial population doubles at regular intervals. Thus, the E. coli cells grows in a…
Q: RELATIVE HUMIDITY 1. the amount of water vapor in grams per cubic meter of air at a given…
A: Humidity is known as the presence of water vapor in the atmosphere. This is measured by an…
Q: Biology Question
A: Introduction Taxonomy is the branch of science that deals with the classification of organisms in…
Q: In which of the following types of exercise would creatine phosphate (CP) be an important source of…
A: Introduction The phosphate-storage molecule group includes creatine phosphate. This chemical can be…
Q: Do the bottom diagram Find all th calculations Micrograph width is 0.2mm at 400x Draw a micrograph…
A: at 1000x magnification = 1.78mm x 100 divided by 1000 = 0.178 mm or 178 micrometers. Stage…
Q: What is phylogeny and morphology, and what are some of the pathogenic traits and animals that they…
A: Please follow step 2 for detailed explanation.
Q: Vaccination is the form of specific immunity usually results in generation of memory of a particular…
A: Introduction :- Vaccination is the process of administering a vaccine to aid the immune system in…
Q: What are factors that can affect the donnan equilibrium?
A: When a liquid of an electrolyte having two diffusible ions is divided by a barrier from some other…
Q: What would a scientist need to use CRISPR-Cas system to introduce a specific point mutation into a…
A: When the target DNA is located, Cas9, one of the CRISPR system's enzymes, latches to it and chops…
Step by step
Solved in 3 steps
- how are okazaki fragments created?11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1https://drive.google.com/file/d/1fOtSuZ_NNdi7qRXHCkM6mtvwRS0pl8u6/view?usp=sharing Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the same values for other DNA and RNA models that will be constructed for instance? Why?
- For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI HindIII 625 2150 HindIII 700 PstI clal 750 РКАВОО 2700bp 915 1900 SpeI AluI 1050 1525 BamHI ori You wish to make a recombinant DNA molecule that will contain one piece of pKABOO vector DNA and one piece of frog DNA so that you can clone a segment of frog DNA. You want cells containing your recombinant plasmid to be amp' and tet and you want to use enzymes that cut within the insertional marker gene. (Note that tet means that there is no functional tet gene in the plasmid.) Be sure that your plasmid has the ability to replicate autonomously in a bacterial cell. You do not have to include the entire frog DNA given below in your recombinant plasmid. Restriction enzymes would be used to clone segment of frog DNA The size of the recombinant plasmid is bp. The recombinant plasmid when transformed into E. coli confers resistance to which of the following antibiotics: Oampicillin only Otetracycline…
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHTo test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T G G C A T A A C A C T 5' Note: Prepare the partner strand of the given DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.If you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'
- https://youtu.be/8kK2zwjRV0M Describe the purpose or theme of the video. Question 2 What are the chemical components of a DNA nucleotide? Question 3 List three characteristics of the structure of the DNA molecule. Question 4 Suppose you have a 5'-AGAGTGCGTA-3' sequence on one strand of the DNA. What is the base sequence that should appear on the other complementary strand of the DNA?In addition to correcting DNA mismatches, themismatch repair system functions to prevent homologousrecombination from taking place between similar but notidentical sequences. Why would recombination betweensimilar, but nonidentical sequences pose a problem forhuman cells?A Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA