Spot the difference between the chemical structures of DNA & RNA and state the said difference in a short paragraph. Please refer in the attached picture for the answer. DNARNABaseBase"0-P-0 ÇHCH2-0-e-0-CH,HHDeoxyriboseCH13' 21OH HPhosphatePhosphateRiboseCH (sugar)13 2OH(sugar)NucleotidesDeoxyriboseRiboseCCSugars

Deoxyribo nucleic acid is abbreviated as DNA and Ribonucleic acid as RNA. They are the molecules…

Answered: Spot the difference between the…

Spot the difference between the chemical structures of DNA & RNA and state the said difference in a short paragraph. Please refer in the attached picture for the answer.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: In one paragraph, using your own words, describe the structure of DNA. Be sure to include the…

A: Introduction :- DNA, or deoxyribonucleic acid, is a long, double-stranded molecule that contains the…

Q: Match the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule…

A: mRNA, tRNA, and rRNA are three types of RNA (ribonucleic acid) molecules involved in protein…

Q: Draw and identify the three parts of a DNA nucleotide.

A: The organic molecule that acts as the building block of DNA and RNA is called a nucleotide. It…

Q: MATCH each of the following terms to a structure from the list below. There is only one correct…

A: Hope you understand...... Please do rate..... Thankyou :) Have a good day ..

Q: Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new…

A: Answer is Option c(Deletion of three nucleotides) and explaination is given in the following steps:…

Q: This is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how…

A: Centrifugal force is based on density gradient In a centrifuge the densest object settle at the…

Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: Which of the following combinations are true of the nucleotide composition of a sample of DNA?…

A: Deoxyribonucleic acid (DNA) is the chemical name for the molecule that carries the genetic…

Q: Deoxyribonucleic Acid (DNA) and Ribonucleic Acid are the two main nucleic acids. In all living…

A: Nitrogenous bases are heterocyclic and water insoluble molecules. These nitrogenous bases are two…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Optional) Describe the structure of DNA, discussing the DNA helix and the base pairs of ONA, the…

A: Introducion There are two types of nucleic acid present in our body. DNA and RNA. DNA acts as a…

Q: In computer science, a bit stores one of two states, 0 or1. A byte is a group of 8 bits that has 28…

A: The word “Genome” defines the total genetic content of an organism. It is able to provide the…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

Q: Adenine and guanine are referred to as Select an answer and submit. For keyboard navigation, use the…

A: A nucleic acid is an important class of macromolecules that are located in all cells and viruses.…

Q: Consider Molecule X in the sketch below: protein- ribosome What is the name of X? Your answer should…

A: The Greek term "soma," which means "body," and "ribo," which refers to ribonucleic acid, are the…

Q: Draw a nucleotide and clearly laber its three component parts.

A: The primary structure of a protein is encoded in the sequence of a nucleic acid. The nucleic acid is…

Q: The shape of an enzyme is important in its ability to function. Enzymes are used in processes in the…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: DNA nucleotide base pairings: Thymine pairs with ___________________________, Cytosine pairs…

A: DNA is a nucleic acid made up of several units of nucleotides joined end to end. A nucleotide is…

Q: Please help me make an abstract using the information below it is the result and discussion of the…

A: DNA i.e. Deoxyribose nucleotide : It consists of nitrogen bases i.e. Adenine , Guanine , Cytosine…

Q: Choose

A: Introduction :- DNA fingerprinting is a method used to identify an individual from a sample of DNA…

Q: The sugar of the nucleotide provides the energy to link two nucleotides together.

A: DNA is the polymer of nucleotides.

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: In some cases, as an enzyme does its job it leaves a situation which must later be resolved by…

A: The process of DNA replication involves the duplication of a cell's genetic material. It supports…

Q: Draw a Lineweaver-Burke plot with two lines, one representing an uninhibited enzyme and another…

A: Competitive inhibition of Lineweaver–Burk plot increases the slope of the line and alters the…

Q: If the sequence of one strand on DNA is… CTA GCT CCA its complementary strand will be… _____________

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: Briefly compare the composition of DNA versus that of RNA. Answer the following questions…

A: Introduction DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are two types of nucleic acids…

Question

Spot the difference between the chemical structures of DNA & RNA and state the said difference in a short paragraph. Please refer in the attached picture for the answer.

DNA
RNA
Base
Base
"0-P-0 ÇH
CH2
-0-e-0-CH,
H
H
Deoxyribose
CH
13' 21
OH H
Phosphate
Phosphate
Ribose
CH (sugar)
13 2
OH
(sugar)
Nucleotides
Deoxyribose
Ribose
C
C
Sugars

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which often start with sequence GU and end with the sequence AG).
Define the following terms:a. protein motifb. conjugated proteinc. dyneind. zwitterione. electrophoresis
Identify the base labeled B. cytosine thymine O adenine O guanine A с B D
A nucleotide is the monomeric building block of the polymer of DNA. To better understand the characteristics of DNA, it is important to understand how the monomers join to form the polymer. Use the following diagram of DNA (and the diagram of a nucleotide in the PowerPoint presentation) to label the listed features: 3' and 5' ends, nucleotide, phosphate group, sugar group, phosphodiester bond, nitrogenous base (pyrimidine and purine), and hydrogen bonds. NHZ NH2 HN OH₂N NH₂ 5. Looking at the polymer, why is a DNA considered antiparallel? 6. Why are the ends of DNA strands named 3' or 5'? 7. How do A:T interactions differ compared to G:C interactions? How does this affect stability of the bond pairs? 8. During gel electrophoresis, to which electrode (+ or -) does DNA migrate? Why?
Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons 1 through 5.
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPER
The phosphate group furthest from the sugar in a nucleotide is the phosphate --- Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a) alpha b) beta c) gamma d d) none of the above
Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT
consider dna nucleotide sequence ATCGGATCGA What structure of dna does the sequence represent?
Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:
Indicate if the following statements are true for DNA, RNA, both, or none. Your answers should be one of the following 4 words: DNA, RNA, the word both if the statement applies to both DNA and RNA, or the word none if the statement does not apply to either DNA or RNA. Are nucleic acids The nucleotides are attached using alternating sugars and phosphates Is double stranded Uses the nucleotide uracil Can be found in both the nucleus and the cytoplasm Uses the nucleotide thymine Uses the sugar ribose Uses the sugar deoxyribose