Ryan has sprained his ankle for the fifth time in the last few years. He believes he is now more prone to spraining it than he used to be. It also takes several weeks for it to feel better, unlike Grace, who twisted her ankle last weekend, but it feels better already. Explain what may be going on here on a molecular level, using the following questions as guidelines: Why does it often take longer for a sprain to heal than it does simple breaks? Propose a molecular reason that might explain why Ryan sprains his ankle more often now than he used to. 3. What sort of treatment do you think Grace may have used to speed up her healing? On a molecular level, how would this help?

Ryan has sprained his ankle for the fifth time in the last few years. He believes he is now more prone to spraining it than he used to be. It also takes several weeks for it to feel better, unlike Grace, who twisted her ankle last weekend, but it feels better already. Explain what may be going on here on a molecular level, using the following questions as guidelines: Why does it often take longer for a sprain to heal than it does simple breaks? Propose a molecular reason that might explain why Ryan sprains his ankle more often now than he used to. 3. What sort of treatment do you think Grace may have used to speed up her healing? On a molecular level, how would this help?

Similar questions

(a) How does the duplication of individual genes occur? (b) individual that inherit a genetic condition known as xeroderma pigmentosum exhibit an extreme sensitivity to sunlight exposure and often develop skin cancer by the age of 10. What repair pathway is most likely disrupted as a result of such mutation? Explain why?
Stanley Miller and Harold Urey created an experiment that simulated conditions on early Earth. Building on the results from this experiment, scientists decide to test the effect of varying the initial amount of NH3 on monomer formation. They set up the same simulation with the exception of starting with three different concentrations qf NH3. The amounts of H2 and CH4 are kept constant in each treatment. They run five simulations per NH3 concentration, as well as five simulations that only have H2 and CH4. Why did the scientists run five simulations with no NH3? * To test the hypothesis that early Earth's atmosphere contained no NH3. This serves as the control group. To test the effect that H2 and CH4 have on monomer formation. NH3 is a controlled variable. Caheele y Bleg PRIVACY POLICY | Terms of Use
Is the following statement true or false?Why? “The flow of genetic information in the cell is alwaysDNA -> RNA -> protein.”
Define a mutation and explain how mutant forms are identified.
Which, if any, of the following statements is false? a) Most of the inherited changes in our DNA arise because of exposure to extracellular mutagens, including radiation sources and chemical mutagens. b) Most of the inherited changes in our DNA arise because of unavoidable endogenous errors in cellular mechanisms and harmful effects of certain natural molecules and atoms within our cells. c) Errors in DNA replication and DNA repair are a major source of mutations in our cells. d) Significant chemical damage is sustained by DNA because of its proximity to water molecules in our cells.
As discussed, the overall rate of mutations in humans is estimated to be about 1 × 10−8 mutations per base pair per generation. How many new mutations would you expect each person to carry, on average, based on this mutation rate? Other studies have estimated that each person carries about 100 new loss-of-function mutations. How does this number compare with your estimate of the number of mutations based on the mutation rate? What might account for any differences?
Using the information provided below, which of the individuals A and B have: i) Genotypic change ii) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q F P WA V Q T W Y D S L GAI .. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the mRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter G UAU UCU c Phe UCc UGU UUC U UUA UAC JTyr UGCCYS Ser UCA UCG UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu G. CUU CCU CCC Pro CAU CAC Hi. CAA CAGJ CGU CGC CUC CUA Leu CCA Arg CGA Gin CUG CCG CGG AUU ACU ACC ACA AUG Met ACG LAsn AGUser AAC AUC…
What is a genetic mutation? How do they influence the synthesis of proteins and/or the onset of disorders?
Considering that we are all made up of the same 4 nucleotides in our DNA, the same 4 nucleotides in our RNA, and the same 20 amino acids in our proteins, why are we so different from each other? For example, why do some people have sickle cell anemia and others don't?
Explain what is meant by loss of function mutation. Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a gene Explain the underlying cause of inborn errors of metabolism (a diagram can be used to illustrate your answer). Give an example of an inborn error of metabolism and explain how the underlying genetic defect leads to the symptoms seen in the disease
Most genetic mutations are deleterious, producing negative effects. True or false?
If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein remains functionally the same; which of the following would best describe the result of this mutation? 1) frameshift mutation. O 2) insertion mutation. O 3) silent mutation. 4) nonsense mutation. O 5) back mutation.