RNA- degrading enzyme.
Q: Test Done and Result Molisch test Benedict's test Barfoed's test Lugol's lodine Orcinol's Test Carbo...
A: Molisch's test yields positive purple ring for all carbohydrates Seliwanoff's test gives yellow colo...
Q: adjust blood pH on the order of hours to days. Secretion of outside the kidneys via ion exchanger to...
A: For appropriate physiological functioning, the concentrations of acids and bases in the blood must b...
Q: What is the best interpretation from the results?
A: 1. Negative ninhydrin test shows that the sample does not contain free amino acids. 2. Positive xant...
Q: Draw a hydropathy plot and a 2D protein cartoon for a protein that passes through the lipid bilayer ...
A: Based on the polarities of the side chains of amino acids they can be arranged in a hydrophobicity s...
Q: Write the net ATP in glyconeogenesis and write the net reaction of it...
A: Glyconeogenesis is the synthesis of sugars like glucose and glycogen from sources other than carbohy...
Q: What is annealing?
A: PCR involves three important steps denaturation, annealing and extension. PCR is used for DNA and RN...
Q: Hello sir, I khow it lakes preciouS Lab. Sheet-Level time, Please, I have a report on this Semester ...
A: The measure of Cytotoxicity or cytotoxicity assays are required to measure or find out the ability o...
Q: What type of linkage/s are present in Lactose? a(1 → 4) only O B(1→4) only O a, B(1→ 2) only O a (1→...
A: Lactose is known also as milk sugar since it is found in milk of mammals. It is important as an inf...
Q: rollowing -passed; 1.e., odui ucing nto the electron transport chain without using this complex are ...
A: ETC or electron transport chain is the process which leads to ATP synthesis. The ETC occurs in the i...
Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were co...
A: Rf value is defined as distance travel by compound divided by distance traveled by solvent. Given Rf...
Q: Find a protein of your choice, choose a part of it (containing at least 30 amino acid residues), fin...
A: A 60 amino acid long portion of the protein (an enzyme ) trypsin from a species of camel (Camelus dr...
Q: Four amino âĉid samples were subjected to a reverse-phase chromatography set up and yielded the foll...
A: Retention factors (Rf) values are important since they determine the differential separation of the ...
Q: Which precursors accumulate in patients with niacin deficiency. What effect does this deficiency hav...
A: Niacin is a precursor to nicotinamide adenine dinucleotide (NAD+) and nicotinamide adenine dinucleot...
Q: Why is there such a large range of ∆G for the second step of glycolysis?
A: Glycolysis is the sequence of reactions that are used to break down glucose into two three-carbon co...
Q: One of the key biological characteristics of SARS-COV-2, as well as several other viruses, is the pr...
A: SARS-CoV-2 uses several members Protein as active antigens. One of the most important is the Spike p...
Q: What changes in the structure of each polysaccharide affect its gelling property? Explain
A: Colloid polysaccharides, proteins, and synthetic polymers are used to make gels, which are solid, je...
Q: Which of the following is not a helix destabilizer? O Adjacent amino acid residues with big, hydroph...
A: A helix is a protein secondary structure that is defined as the regular arrangement of nearby residu...
Q: Predict the results you would get if your Cytosine DNA sample was inadvertently contaminated with th...
A: DNA is a nucleic acids and polymer of nucleotides linked by phosphodiester bonds. It is composed of ...
Q: Look at the structure shown below and answer the following questions: HN NH но NH Download image. a....
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide bonds...
Q: How to identify the Vmax and the Michaelis constant (Km) in an enzyme kinetics graph?
A: Vmax and KM are the two parameters that define the kinetic behavior of an enzyme as a function of [S...
Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were co...
A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The rever...
Q: Which of the following is true of primers that are used in DNA replication? They are made out of ...
A: DNA replication is the process of copying the DNA ,in which the both the strands of the DNA molecule...
Q: Which of the following characteristics of B-sheet is incorrect? O In anti-parallel fashion, strands ...
A: Proteins are the polymers of twenty standard amino acids attached together via peptide bonds. The li...
Q: Match the following- A. Fibrous protein 1. Peptones B. Globular protein 2. Metaproteins C. Primar...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Provide an example where "gradient" acting as a force and driving life
A:
Q: Modified true or false. Write the correct answer if the underlined word is false. 1. The zinc ion i...
A: A zinc finger is a tiny protein structural motif defined by the coordination of one or more zinc ion...
Q: Amino acids are classified according to the R group linked at the carboxyl group. a. True b. False
A: Amino acids are the monomeric units of the proteins. Generally , 20 types of amino acids are found i...
Q: quantitatively measure the concentration of carbohydrates
A: Benedict's test is mainly used for detection of reducing sugar in the given analyte solution. It is ...
Q: How does adjusting Mg2+ concentration affect the PCR yield and specificity? How does adjusting prim...
A: Introduction: Polymerase chain reaction involves the ampliifcation of a particular piece of DNA to p...
Q: Draw a peptide from the given amino acids Phe-Cys-Ala-Arg-Ala-Ser-Tyr. Try to cleave this oligopepti...
A: Pepsin exhibits a broad cleavage specificity but has a tendency to cleave the polypeptide chain in t...
Q: n the living cell, free energy made from one reaction can be used to drive another in an energetical...
A: Glycolysis is also known as the Embden Meyerhof pathway and it is highly conserved from ...
Q: sub= 18 help
A: The reaction given in the question involves the conversion of dihydroxyacetone phosphate to glyceral...
Q: Why is the peptide formation always presented/read from N-terminal to C-terminal?
A: Introduction: Amino acids are joined together by a condensation reaction between carboxylic and ami...
Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and effi...
A: DNA replication is a complex process of producing copies of the entire chromosome using the templa...
Q: Which of the following is the correct statement for the a anomer and B anomer of D-arabinose? O They...
A: D-Arabinose: Arabinose is a monosaccharide with 5-carbon atom. It has a aldehyde functional group he...
Q: Statements: (1) Polysaccharides usually give a negative Benedict's test. (2) The hydrolysis of cel...
A: We will discuss the statements first and then see which is the correct option
Q: a sample that contains a carbohydrate delivers a negative starch iodine test. what does this result ...
A: Introduction: Carbohydrates are polyhydroxy aldehydes or polyhydroxy ketones with a molecular formu...
Q: If you had a 50 mL volume of 1% agarose gel to create with appropriate amount of SYBR Gold how would...
A: Agarose gel electrophoresis is a gel electrophoresis method of used separate a mixture of macromole...
Q: The electron transport chain (ETC), or respiratory chain, is linked to proton movement and ATP synt ...
A: Introduction: The electron transport chain is the movement of electrons from NADH and FADH2 to oxyge...
Q: Which tests both result in a colorimetric change due to furfural complexation? Molisch's and Benedi...
A: Molisch's test detects the presence of carbohydrates in a given sample. It distinguishes carbohydrat...
Q: Explain why people with a deficiency of the enzyme glucose 6-phosphate dehydrogenase (G6PDH) suffer ...
A: Glucose 6-phosphate dehydrogenase(G6PDH) deficiency is an X-linked disease. In normal, G6PD is req...
Q: What amino acids are present on the unknown sample based on the results below? Test/s Results Ninhyd...
A: There are several test, which are used to perform in order to identify the specific amino acid in a ...
Q: Do you feel that laboratory animals should be used in experiments in toxicology? Why or why not?
A: People and our quality of life benefit from research using laboratory animals. Most people on the ea...
Q: Determine the catalytic power of jack bean urease in catalyzing the hydrolysis of urea given the fol...
A: ENZYMES : - Enzymes are defined as the organic molecules which helps in catalyzing the reaction....
Q: Catalase is an enzyme that catalyzes hydrogen peroxide to become oxygen and water. Which type of spe...
A: Enzymes are biological catalysts that increases the rate of biochemical reaction without itself bei...
Q: Which two amino acids may be encoded in genes by stop codons? O A. L-Ornithine and L-Citrulline O B....
A: Amino acids are the building blocks of protein. They contain amino group and carboxyl group along wi...
Q: Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to...
A: The Central dogma of molecular biology involves the synthesis of RNA using DNA as template by the pr...
Q: The ability of non-polar substances like fat molecules to clump together in water thereby allowing m...
A: Fats are non-polar molecules and generally insoluble in water. Non-polar molecules can not make hydr...
Q: Calculate the approximate molecular weight of a protein composed of 303 amino acid residues in a sin...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Which of the following equations accurately shows enzyme-catalyzed conversion of substrate to produc...
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...
- RNA- degrading enzyme.
- DNA Helicase
- Deoxyribonuclease
- Protease
- Ribonuclease
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- The direction of movement of RNA polymerase along the template to generate supercoiled structures in reference to the given figure and whether supercoils would be generated if RNA polymerase were free to rotate about the DNA axis.TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.Comprehensine. mfometion regordng boctenal replication Should be provided..
- Please help me with this please. I really don't know how to make this. I really do appreciate you're help. 1. make a simple illustration to relate the different kinds of DNA to its function.Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedureTRUE OR FALSE. Non-homologous end-joining as a DNA repair mechanism does not result in loss of nucleotides as a result of a double-strand break.
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3pros of phenotypingA cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.
- True or False. Do single-stranded DNA strands stabilize other strands?The relationship between the nucleotide sequence of an mRNA and the DNA strand from which it is transcribed. Messenger RNAs are synthesized by RNA polymerases that read along a DNA template strand in the 3'→5' direction, polymerizing ribonucleotides in the 5'→3' direction. Give the nucleotide sequence (5'→3') of the DNA template strand from which the following mRNA segment was transcribed: 5'-UAG UGA CAG UUG CGAU-3’Suggest a reason why there are two classes of aminoacyl-tRNA synthetases, with each class recognizing a different face of the tRNA.
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Lehninger Principles of Biochemistry](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Fundamentals of Biochemistry: Life at the Molecul…](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Fundamentals of General, Organic, and Biological …](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)