Question 9 Listen Cystic fibrosis causes breathing problems, failure to maintain weight (due to digestive issues) and male sterility. Therefore this condition can be described as pleiotropic a) True b) False

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: Question 10 The proteins and other substances that bind to the DNA rely mostly on non-covalent…

A: A substance that is mainly made up of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus…

Q: Genetics Question 1

A: Since Violet has the same genes as Ramone and Tina in both Gene 1 and Gene 2, it suggests that she…

Q: Genetics Question 8

A: Gene 1:Ike's alleles: A, BBrenda's alleles: C, DJoe's alleles: A, CGene 2:Ike's alleles: X,…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Which of the following is considered a "palindrome" in DNA? O GGATCC O AATTAA O CGATAGC

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: A sample of double-stranded DNA contains 20% adenine. Approximately what percent of the nucleotides…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Genetics Question 9

A: The objective of the question is to determine whether a mutation in an enhancer that prevents the…

Q: 4 The complete genome of the simplest bacterium known, Mycoplasma genitalium, is a circular DNA…

A: Introduction-- Dna topoisomerase enzyme act to regulate Dna supercoiling by catalyzing the winding…

Q: How many functional groups does the peptide MDFGRKCDE have that can be titrated? 6. 8. 7 O O O O

A: In organic molecules, the functional groups., which refer to the specific group of atoms presenting…

Q: Question 18 Replication origins have Repetitive lines; histone G-C rich; Helicase A-T rich; histone…

A: Introduction :- Histones are proteins that attach to DNA, form chromosomes, and regulate gene…

Q: wou performed the Meselson-Stahl experiment using the bacterium E. coli and observed two bands after…

A: Meselson and Stahl together deciphered that the DNA divides semi-conservatively. The…

Q: uestion 18 Recessive mutations in autosomal genes purple eye (pr), curved wing (c) and black body…

A: Genetic mapping:based on the calculation of recombination frequency.The concept of genetic mapping…

Q: Question 23 Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a…

A: A series of genetic diseases collectively referred to as sickle cell disease includes sickle cell…

Q: 0-P-O- H,N N- A ÓH -P-O- `NH U OH 0-P-O- Он ОН This is RNA This is DNA This chain is a polymer. The…

A: The two main types of nucleic acids are DNA and RNA. Both DNA and RNA are made from nucleotides,…

Q: Question 10 of 10 Question 10: What percent of the human genome encodes protein?

A: Answer

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity.  Complementarity is…

Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…

A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…

Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…

A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…

Q: 50. Which of the following represents the inactive X-chromatin in female cells? O euchromatin O…

A: Given: The following represents the inactive X-chromatin in female cells.

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…

A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…

Q: Question 6. List the five steps in cell migration in order:

A: Cell migration is an essential mechanism in the growth and maintenance of multicellular organisms.…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.