Question 19Which of the following is FALSE in relation to CRISPR/Cas9?O Cas9 needs a PAM site consisting of an NGG sequence.O Cas9 will make a double stranded break between basepairs 3 and 4 from the PAM site.O The crRNA molecule contains a 20 nucleotide sequence that matches a sequence in the genome.O Off target effects are not really a concern.Question 20What happens after a double stranded break is induced in the DNA? Select the statement that is FA

Cas9 needs a PAM site consisting of an NGG sequence. True - The Cas9 enzyme requires a short…

Answered: Question 19 Which of the following is…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.
QUESTION 12 Which of the following is NOT a step in the formation of LTRS? O A. Binding of a tRNA primer to the primer binding site sequences on the retroviral RNA genome O B. Synthesis of a DNA segment starting from a primer hybridized to the RNA poylpurine tract by DNA polymerase O C.A jump in which an R segment (DNA) hybridizes to an (RNA) R segment on the 3¹ end of the retroviral RNA genome O D. Degradation of an RNA strand by RNase H that stops at the primer binding site O E. Circularization by annealing of the single-stranded primer binding sites (PBS) to one another
Question 25 What is a major drawback of performing genome editing with site-specific endonucleases over RNA-guided endonucleases? difficulty in transformation Necessity of protein cargo to facilitate the editing the need to genetically engineer a new endonuclease for each target sequence. Specificity is not achieved Question 35 Identify the disease: Affected people are usually born to unaffected parents. Parents of affected people are usually asymptomatic carriers. It affects either sex. After the birth of an affected child, each subsequent child has a 25% chance of being affected (assuming that both parents are heterozygous carriers). X-linked dominant Autosomal recessive Y-linked X-linked recessive Question 36 Using Sanger sequencing, starting from the sequencing primer, what is the sequence of the DNA sample ? Question 36 options: G T A C C C G A A A T C A G G A A G…
Question 1 In the second step of lariat splicing the 2'OH group of a G in the branch point attacks the 3' splice site O the 3' OH group of the first exon attacks the 3' splice site the 3' OH of the first exon attacks the 5' splice site O none of the above A Moving to another question will save this response. MacBook Pro
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
Question 16 The full set of different transcripts expressed by a cell is called Question 16 options: Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is Question 17 options: allows quantification of transcripts over five orders of magnitude used to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Question 18 options: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with…
Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.
Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…
Question 5A You are doing a genetic engineering experiment. You use restrictions enzymes to cut the regulatory sequences from the lac operon and replace them with the regulatory sequences of the trp operon. Specifically, you will eliminate everything upstream of the beginning of lacZ and replace them with the trp sequences upstream of the beginning of trpE, including trpR. Now, describe the regulation of your ñew constructed gene. What will you do to get expression of the three lac genes? The lac Operon and its Control Elements lacl CAP PO lacz lacY lacA genes 5 binding site 3 DNA AUG AUG AUG messenger RNA RNA polymerase blocked from transcribing trp operon Regulatory gene trp operon DNA PR trpR Ptrp trpE trpD trpC trpB trpA Repressor bound to operator Promoter 5' 3' trpR-MRNA (a) Tryptophan present, repressor bound to operator, operon ropressed. When complexed with tryptophan, the repressor protein produced by the trpR gene binds tightly to the trp operator, thereby preventing RNA…
QUESTION 16 CRISPR in nature evolved as a "bacterial immune system" or "genetic vaccine" to target infecting viruses. What aspect of the system can we now manipulate so that you can promote *more* transcription of a desired gene? O A nuclease deficient cas9 a single amino acid mutation in Cas9 o edit the PAM sequence supply a DNA template with the cas9/guide RNA use a special guide RNA
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer
QUESTION 11 Which of the following statements about RNA interference pathways and mechanisms is FALSE? O A Investigators can load RISC and/or RITS complexes with artificial, designed RNAS in order to specifically target and silence a gene of interest as a way to see what the effect of that gene is when its expression is silenced. O B. Only a small section of a small interfering RNA, called the 'seed' sequence, is actually used to identify nucleic acid targets that are to be silenced. OC. Eukaryotic RNA interference pathways do not regulate genes from the genome itself (i.e. endogenous genes), they only respond to external infection events such as invading viruses. The piRNA pathway processes small RNAS out of long noncoding RNA transcripts and is important for suppression of repetitive element movement in germ cells. OD. O E. The micro (n RNA pathway and the short interfering (si) pathways load small RNAS into RISC or RITS complexes.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS