Question 12 Which of the following best describes the assembly process to initiate translation in prokaryotes? small subunit associates with MRNA; IF w/ bound NTP brings in first f-Met-TRNA; IF then hydrolyses bound NTP; large subunit A associates small ribosome subunit associates with large subunit; MRNA associates next; IFs bring in first f-Met-TRNA; bound NTP (B hydrolyzed. IF binds f-Met-TRNA; small ribosome subunit associates next; MRNA associates next; then large subunit; bound NTP hydrolyzed. IF w/ bound NTP binds f-Met-TRNA; MRNA associates next; small subunit associates next; bound NTP hydrolyzed; large subunit associates.

Q: QUESTION 28 Which of the following describes how a protein is inserted into the ER membrane? OA. It…

A: Introduction: Endoplasmic reticulum is present in all eukaryotic cells. Its membrane normally makes…

Q: Post-transcriptional control of gene regulation: None of the above Can stop gene expression quickly…

A: Proteins are a type of macromolecules that are critical for different varieties of roles in cellular…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…

A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…

A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…

Q: QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition…

A: Leucine zipper is formed by the dimerization of two specific alpha helix monomers bound to DNA.…

Q: How has regenerative medicine advanced in its ability to repair spinal cord injuries (SCI) with…

A: Spinal cord Injury- it is very debilitative disorder with minimum treatment.  The incidences of…

Q: QUESTION 22 If polynucleotide phosphorylase (PNP) synthesizes random RNA when given a 50-50 mixture…

A: Codons are trinucleotide bases of DNA or RNA that code for specific amino acids. There are 64 codons…

Q: When present, the TATA, CAAT and GC boxes are typically found within 100 - 150 bp upstream from the…

A: The TATA box is a conserved nucleotide sequence located around 25-30 base pairs upstream of the…

Q: The term "gene expression" refers to the O process by which genetic information is transformed…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Question 15 The higher protein abundance observed in the ACE20E allele compared to the wild- type…

A: Introduction  The expression of genes is highly regulated in both prokaryotes as well as in…

Q: Question 17      3′ CCA addition to tRNAs is necessary to ensure:   Question 17 options:   correct…

A: Question 17:   The 3′ CCA addition to tRNAs is necessary to ensure that they have correct…

Q: QUESTION 46 Vancomycin and B-lactam antibiotics are similar in what way? OA. They both prevent…

A: Vancomycin and Beta-lactam are two classes of antibiotics that are used to treat bacterial…

Q: QUESTION 4 Suppose you have a length of DNA sequence that corresponds to a complete mRNA open…

A: Q4. The correct option is D i.e, look for splice sites GT-AG thise should only be present if the DNA…

Q: QUESTION 10 Which one of the following is TRUE? A codon O is the basic unit of the genetic code…

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.