Question 15 The higher protein abundance observed in the ACE20E allele compared to the wild- type (ACE2*) allele is caused by altered regulation of gene expression at the post- transcriptionalL level. Which of the following mechanisms are a likely explanation for the abnormally high protein expression from the ACE20E allele? Select all that apply C Increased length of the poly-A tail increases mRNA stability and translational efficiency Alternative splicing makes a shorter protein that is translated faster Faster 5' capping increases MRNA stability and translational efficiency Decreased microRNA expression reduces translational inhibition and ACE2 MRNA degradation All of the above mechanisms are likely explanations

Q: In trans splicing O two introns from different transcripts are brought together two exons from the…

A: Answer: SPLICING = It is the cutting or removal of introns from the mRNA transcript and joins the…

Q: Question 7 What experiment could you perform to test if KDEL is necessary for protein retention in…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Changes in function of which of the following protein by posttranslational modification (such as…

A: Gene expression is a phenomena in which a gene is expressed into a functional product either in the…

Q: -up) genes, which Question #1: The diagram below depicts the regulatory regions for contain…

A: The gene has cis-regulatory sequences, to which the transcription factors bind and will control the…

Q: Post-transcriptional control of gene regulation: None of the above Can stop gene expression quickly…

A: Proteins are a type of macromolecules that are critical for different varieties of roles in cellular…

Q: Under which conditions does the trp repressor block transcription of the trp operon? when the…

A: The trp operon responds to a repressor protein that binds to two molecules of tryptophan. When the…

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: Which of the following statements is FALSE regarding Enhancers? O Enhancers are sometimes found in…

A: As the word suggests enhancers are used for enhancing. Enhancers are segments of DNA that are…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: Which of these statements best describes the major difference between enhancers and promoter…

A: Enhancer sections are regulator DNA regions that promote the transcription of a linked gene when…

Q: Question 2 Which example is describing a "missense" mutation? OThe normal amino acid sequence of a…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: Question 5 What mutation would result to a change of AUG codon to AGG? O missense mutation nonsense…

A: A mutation may lead to a change in the sequence of bases in DNA or RNA. Mutations occur as a result…

Q: Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it…

A: Primary transcript, also known as heterogeneous nuclear RNA (hnRNA), refers to the initial RNA…

Q: Indicate what component (A to E) in the drawing corresponds to each of the following:   Enhancers,…

A: By means of a process called DNA transcription, RNA polymerase rewrites the genetic data present in…

Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…

A: For termination of mRNA sequence a stop codon has to be present it can be  UAG  UAA  UGA

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Consider the gene that encodes telomerase RNA. Suppose that the sequence of the template strand that…

A: DNA is composed of nucleotides. There are two purine bases - -Adenosine (A), and Guanine (G), and…

Q: Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region…

A: How a deletion mutation in the 3' UTR of CACNA1S mRNA could lead to hypokalemic periodic paralysis…

Q: QUESTION 39 Histone acetylation leads to which of the following events? Oa. DNA becomes more tightly…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: HATS O place phosphate groups on histones O Place acetyl groups on histones O make regions less…

A: The mechanism for acetylation and deacetylation takes place on the NH3+ groups of lysine amino acid…

Q: QUESTION 4 Tissue-specific patterns of gene transcription in multicellular organisms is regulated O…

A: Transcription is the process involved in making of RNA copy of a gene sequence.This copy is known as…

Q: QUESTION 9 Shown is a segment of DNA with its promoter and terminator. Start and end of…

A: Given: Segment of RNA with exons and introns of length: Intron 1: 15 Intron 2: 17 Intron 3: 14 Exon…

Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…

Q: What the gene product

A: Gene regulation in bacteria Introduction We tend to think of bacteria as simple. But even the…

Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…

A: Genetic code exists in the form of codons and these codons are the sets of three nucleotides. There…

Q: Enzymes that acetylate the e-amino group of lysine in the histone tails are called and are involved…

A: Histone is made up of majority lysine and arginine (positive amino acids) as a result negative…

Q: QUESTION 12 Which of the following is NOT a step in the formation of LTRS? A. Binding of a tRNA…

A: Introduction LTR is A polynucleotide sequence found at each end of an integrated retrovirus genome…

Q: Question 5. What is the effect on a target mRNA when it is silenced by a miRNA that has a complete…

A: Protein synthesis is one complex procedure taken up by the cell and that needs various components to…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture…

A: A microarray is a collection of probes or oligos attached to a chip. Microarray is employed to…

Q: Which one of these mutations would definitely NOT affect the function of the protein coded by the…

A: Mutation is defined as the event where the gene sequence of the DNA is altered giving rise to…

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.