Problem Description a) Create a new code cell or a new python file. b) Write a python code that creates numpy arrays A, B, and C. print the result of A(B+C) _and AB + AC. (2 -1) 2 4 B = 23 and C=| 03, c) A business makes two types of products: A and B. The following table is used in calculating the cost of manufacturing each product: Labour (Hours) Wood (Blocks) Paint (Tin A. 4 Labour costs $8 per hour, wood costs $1 per block and paint costs $2 per tin. Find the cost for each product. Note: in your code, you have to use matmul function.

Problem Description a) Create a new code cell or a new python file. b) Write a python code that creates numpy arrays A, B, and C. print the result of A(B+C) _and AB + AC. (2 -1) 2 4 B = 23 and C=| 03, c) A business makes two types of products: A and B. The following table is used in calculating the cost of manufacturing each product: Labour (Hours) Wood (Blocks) Paint (Tin A. 4 Labour costs $8 per hour, wood costs $1 per block and paint costs $2 per tin. Find the cost for each product. Note: in your code, you have to use matmul function.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

C PROGRAMMING HELP I need help with an old script of mine. I'm having trouble getting math involving accessing an array to work properly, I'm getting an error message that's puzzling me. I'm pretty sure the solution is simple and right in front of me but it's stumping me. Below is the script: #include <stdio.h>#include <math.h>void value(float x){ printf("what is the value of x?"); scanf("%f",&x); }void power(float i,int p,int x,float arr[100]){ float equation,butt; printf("what is the highest power in the series?"); scanf("%d",&p); for (i = 0; i < p; ++i) equation = pow(x,i); //how the hell do i get the counter to do what i want butt = 1+equation^arr[i];}void shortcut(int x){ shortcut = 1/(1-x)}int main(){ printf("Here is the result!:") printf("%d %f", p, f); printf("If we had used shortcut, value would be: %d", shortcut); int diff; diff = shortcut - butt; printf("The difference is only %0.2f!",diff);…
Two dimension array in C:Create a two dimension array of integers that is 5 rows x 10 columns.Populate each element in the first 2 rows (using for loops) with the value 5.Populate each element of the last three rows (using for loops) with the value 7.Write code (using for loops) to sum all the elements of the first three columns and output thesum to the screen. without using #define
Consider the following program specification: Write a program that will prompt the user for 10 integer values and stores them in an array. The values entered by the user only be between 0 and 100 and the program should validate these appropriately. The program should then: Display the average of the values Display the highest value in the array Display the lowest value in the array Discuss how the values should be validated. What control structures could be used? Using eclipse
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Instructions: Using an array, enhance the program that you have performed in the previous exercise. The program should accept multiple entries and iteratively perform the following operations. Submit the source code and screenshot of output. Using a user-defined function and appropriate conditional and looping statements, create a program that will: (a) ask the item price from the user (b) ask how many items to purchase for a specific item price (c) ask if there are other items to purchase, if yes, repeat the first step, proceed to the next step if otherwise (d) compute and display for the total amount to pay (e) ask for the payment from the user (f) accepts only enough amount of payment, ask another payment if otherwise (g) compute and display change
C++ Programming. OVERVIEW OF DATA STRUCTURES. Task: Write a program to process a data array. Execute a custom task as a separate function or method of a custom class. When performing a task, use functional methods for manually entering array elements, generating random numbers, and printing array elements. Given an array of size N. Create a function to determine the element that is furthest from the arithmetic mean of the array elements (that is, the maximum absolute difference).
Programming Language: C++ You have been hired by Google to work on their YouTube videos search team. Every YouTube video has a unique ID and those IDs are in unsorted order. As a software engineer, you are required to make a YouTube search engine which works for very user. Create a test engine that only holds seven YouTube IDs. Prompt for and get from the user the seven IDs and store them in an integer array. Then sort and print the array using the insertion sort algorithm. Finally, use a sentinel loop to prompt for and get from the user a series of IDs. For each ID, perform a binary search on the array and tell the user if it was found or not. If found, print the index where the ID is stored. Continue to prompt the user for an ID until entering the sentinel value of -999. In addition to function main, define the following two functions: void insertion_sort(int arr[], int arr_size) int binary_search(int sort_arr[], int size_array, int search_value) binary_seacrh returns…
C++ Write the program that outputs the following menu. The program should allow a user to input numbers into an array of integers. The array size should be 10. The first number should be stored in the zero position of the array. The next number should be stored in the next available location. Each option below should be written using a procedure, except Quit. Remember to comment the procedures with (given, task and return). (MENU) 1) Input number. 2) Sort numbers. 3) Output numbers 4) Quit Option 1) Allows the user to input a number and store it into the array. If the array is full no more numbers should be input. When the user select option 1 and the array is full it should output (Memory Full!). This option will only allow one number to be entered. If the user want to input another number they will need to select option 1 again. Option 2) This option should take the array and sort it in ascending order. Use the selection sort to do this. Option 3)…
C++ Problem #1: Create a blank 10x10 integer array using constants for the row and column Create a function printArray() that will print every row and column of the array Create a function notFound() that searches each element in the array and returns true if the passed number already exists in the array and false if it does not Create a function fillArray() that will fill the 2 dimensional array with unique random numbers from 0 to 100 inclusive. No cells should have the same number. Use the notFound() function in this function. Print the entire array. Request a column number to print and use a sentinal loop to make sure the row number is valid. If not then request a column number again Create a function printIter() that prints only the passed column using iteration Create a function printRecur() that prints only the passed column using recursion Print the requested column using printIter() and printRecur() Sample output: The array is: Row 0: 41, 85, 72, 38, 80, 69, 65,…
JAVA CODE PLEASE Functions with 2D Arrays Practice ll by CodeChum Admin Write a function named displayElements that takes a two-dimensional array, the size of its rows and columns, then prints every element of a two-dimensional array. Separate every row by a new line and every column by a space. In the main function, write a program that asks for integer input to be assigned on a 3 x 3 array and call the function displayElements to print the contents on the next line. Input 1. Multiple lines containing integer each line Output R1C1:·1 R1C2:·2 R1C3:·3 R2C1:·4 R2C2:·5 R2C3:·6 R3C1:·7 R3C2:·8 R3C3:·9 1·2·3 4·5·6 7·8·9 Score:
Problem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.
FYI: Please write the code in Pseudocode (no programming language please) 1. Write a pseudocode that outputs the contents of parallel arrays. You do NOT have to write the entire program. The first array will hold phone numbers The second array will hold company names You do NOT need to load the arrays. Your code can assume they are already loaded with data. arrays are named phone[] and company[]