Posttranscriptional control in eukaryotes includes O A. chromatin decondensation, RNA processing, mRNA degradation, and protein import into target organelles OB. RNA processing, MRNA degradation, protein import into target organelles, and selective DNA duplication OC. MRNA degradation, protein import into target organelles, and protein-DNA complexing OD. None of the answers is correct.

Q: Pegard to bacteriophage lambda's decision to enter the lytic or lysogenic cycle, which of following…

A: INTRODUCTION A bacteriophage, or phage for brief , is a virus that infects bacteria. Like other…

Q: Termination of DNA transcription in prokaryotes can be   Question 22 options:   intrinsic or…

A: Termination of transcription is the process by which RNA polymerase-catalyzed RNA synthesis on a DNA…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: d) What would happen if the majority of DNA between the enhancer and site of RNA pol binding was…

A: Gene expression is a multistep process involving replication, transcription, and translation as the…

Q: Which of the situations below will enhance microtubule growth? O addition of a drug that inhibits…

A: The third key part of the cytoskeleton, microtubules, are hard, hollow rods with a diameter of…

Q: Which of the following possibilities could explain how PcGcomplexesare able to silence genes?a. The…

A: Gene expression is a regulated process in the cells. Epigenetic modifications can alter gene…

Q: Chromatin Immunoprecipitation is used to : Isolate DNA binding proteins O Identify specific…

A: Chromatin immunoprecipitation,  is an antibody-based technology which is used to selectively enrich…

Q: A gene product of unknown function was subjected to both two hybrid analysis and BioID. In the two…

A: Two-hybrid analysis is a molecular biology technique used to discover protein-protein interactions…

Q: In eukaryotes which of the following combination of chromatin conditions would be most likely to…

A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear membrane.Eukaryotes…

Q: Which of the following mechanisms may be involved when PRC1complexes silence gene expression?a. The…

A: The process of genic expression is used to direct the assembled protein molecule with the encoded…

Q: The repressor molecule, specified by the regulator gene, prevents the structural genes from…

A: Transcription is a process of formation of messenger RNA from DNA by the enzyme RNA polymerase.…

Q: to that in humans. The molecule that is most similar in function to the bicoid and the molecule that…

A: Introduction Transcription is a process in central dogma where the DNA strand is transcribed into a…

Q: What determines the conformation of Mediator? TAND 1 O TAFS 6 and 9 interactions with transactivator…

A: Introduction In All Eukaryotes, Mediator Is A Multiprotein Complex That Acts As A Transcriptional…

Q: On gene expression control what are the correct statements?  MOLECULAR BIOLOGY basic  Eubacteria…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Control of transcription in prokaryotes does not involve enhancers silencers Histone coding O…

A: Enhancers and silencers are DNA sequence acting as regulatory elements which acts as "turn on" or…

Q: Compared to heterochromatin, euchromatin is O comprised of densely packed nucleosomes and with…

A: Heterochromatin is characterized as the region of the chromosome which is obscurely darkled stained…

Q: What are insertion and deletion mutations? Why might they be harmful to a cell?

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: of 22 ow does gene regulation differ between prokaryotes and multicellular eukaryotes? O Protein-DNA…

A: Eukaryotes are multicellular and cells are specialised in to different type of tissue, that…

Q: Which of the following does not contribute to preserving the memory of identity in a dividing cell?

A: It is important for a dividing cell to preserve its identity so that it can be correctly…

Q: xplain any five of the following terminologies: gene regulation, enhancer or silencer sequences,…

A: Introduction: Genomics is an area within genetics that is associated with the sequencing and…

Q: Which of the following factors DOES NOT affect pluripotency? O DNA Acetylation Oct4 Nanog miRNA's…

A: Pluripotency is the ability of stem cells to differentiate into all the cell types of an organism.…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: ing statements about promoters that are true. A promoter specifies where RNA polymerase initiates…

A: Promoter is a specific sequence of dna, where it's length can vary from organism to organism.…

Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…

A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…

Q: Make a concept map that includes the following terms: DNA, mRNA, protein - 10 site, - 35 site,…

A: These terms are related to formation of DNA copy (Replication), conversion of DNA to mRNA…

Q: Which of the following statements is/are true about gene regulation in bacteria? Choose all that…

A: Gene regulation refers to the mechanisms that act to induce or repress the expression of a gene. It…

Q: The association of DNA with nucleosomes means that the default state for eukaryotic genes is to be…

A: By promoting or impeding the attachment of transcription factors along with additional regulatory…

Q: What does it mean to say that a gene is expressed? DNA contains the information needed to make a…

A: Numerous cells aggregate to make up the whole body. Cells are the building blocks of the body. Cells…

Q: how would alterning patterns of gene expression in prokaryotes would most likely serve an organism's…

A: Point mutations A point mutation means change in the single nucleotide base pair in DNA sequence.…

Q: In bacteria sigma factors: 1. Transcript factors 2. Specialized subunit of the core enzyme 3.…

A: In prokaryotic (bacteria) transcription process the RNA polymerase perform the synthesis of RNA…

Q: Where does the transcription occur? Where does transition occur?

A: The answer given is in correspondence with translation instead for transition. We assume that to be…

Q: What is the predicted function of the Duffy gene? O Cell Adhesion Molecule O Microfilament RNA…

A: Gene is the basic structural and functional unit of heredity. A gene exists as two alternative forms…

Q: In the following DNA segment, which genes are transcribed during delayed early transcription? (Hint:…

A: The transfer of genetic information is the main tenet of the religion. It outlines how three…

Q: ose d CAP lac I repressor allolactose CAMP C RNA Pol promoter operator +1 lac Z lac Y lac A DNA

A: E.coli's Lac operon contains the genes required for the lactose metabolism. Genes involved in the…

Q: A peptide tag on a protein is important for the protein to move to its final destination. the…

A: We are supposed to answer one question according to our guidelines. Please repost the other question…

Q: Eukaryotic transcriptional repressors may act by   Choose an answer below competing for a binding…

A: Eukaryotic transcriptional repressor : These are the proteins which bind to the specific sites of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.