Pick two. A species of insect that lives solely on pinesap was found to contain a bacterial symbiont. Genome sequencing of both the host and the symbiont revealed that the symbiont lacked many genes required for energy production, and the host lacked genes for biosynthesis of several essential amino acids. What are the two most likely mechanisms (or, processes) that caused the loss of these genes in each partner? Variable hypermutation rate Transduction Horizontal gene transfer Natural selection Horizontal pathogenesis Coevolution Selective random drift

Q: Discuss any 1 gene regulation mechanism. Describe the gene expression in this type of gene…

A: introduction :  Gene expression is the process of turning genetic information into a functioning…

Q: Explain on how TYR has considerable variety among vastly different species, but can also be…

A: Eukaryotic proteins are usually composed of 20 amino acids. Among the twenty amino acids, some have…

Q: During the transcription of a given portion of a DNA molecule Select one: a. MRNA is synthesized on…

A: Messenger RNA (mRNA) is an RNA sequence that is transcripted from the DNA sequence. This mRNA is…

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: Consider a polycistronic operon consisting of genes B, C, and D (in that order) and with a single…

A: A polycistronic operon is a DNA segment that contains multiple genes that are transcribed into a…

Q: reduction in histone acetylation and reduced gene transcription. Given this information, which of…

A: Transcription is a highly controlled process and it requires the presence of enzymes polymerase and…

Q: Early in development, most human cells turn off expression of an essential component of telomerase,…

A: Telomeres are complex nucleoprotein structures present in the tips of the chromosomes which protects…

Q: You are working with E. coli, studying its metabolism. Your normal lab strain of E. coli can grow…

A: Answer.):- In the field of micro-biology, the study of bacterial meta-bolism provides valuable…

Q: Give 3 advantages of enzyme induction and repression in bacterial systems.

A: Enzyme induction refers to the rise within the quantity of accelerator supermolecule as a results of…

Q: The trpR gene encodes an allosteric protein that binds the amino acid tryptophan and regulates the…

A: Trp operon is also known as tryptophan operon. The tryptophan operon consists of structural genes,…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: Did your mutation actually disrupt binding? Please choose the best explanation based on what you…

A: Protein binding affinity elucidates the intensity of interactions between proteins and their…

Q: Part A. When a mutation arises, it can have three possible consequences for the individual:…

A: A negative, or deleterious, mutation reduces the organism's fitness. A beneficial or advantageous…

Q: C5. A human gene called the β-globin gene encodes a polypeptide that functions as a subunit of the…

A: Classification of Descriptions by Genetics Level:A. Molecular level: This statement describes the…

Q: from the transcription start. Prokaryotic promoters contain the sequence TATAAT at a position 0a-10…

A: Pribnow box is the sequence of six nucleotides which are required for the transcription process.…

Q: E32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects…

A: This technique is used to determine the sites in the DNA where the proteins are bound. It can be…

Q: Explain the concept of tissue-specificity of evolution of mutation rate.

A: In genetics, the mutation rate is the frequency of new mutations in a single gene or organism over…

Q: a. Why does a shift from grain to meat diets create more demand for cereals? b. What is the name of…

A: Cereals are the very important supple edible part of grain. The edible half is reproductive…

Q: Somo mutations, of changes in the sequenco of DNA, do not have any offect on the characteristios of…

A: According to the question, some mutations or changes in the sequence of DNA do not have any effect…

Q: Q34. mRNA decay (breakdown) can play an important role in controlling protein abundance. Which of…

A: mRNA decay or break down takes place in our cell when specific mRNAs are not required anymore and is…

Q: methionine, just in case your yeast happens upon circumstances where it can’t eat methionine. It…

A: To answer your first question:-  Take an instance where your mother has already cooked food for you…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…

A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…

Q: By integrating transcriptomic data and tandem mass spectrometer data, researchers discovered that…

A: Cone snails are marine molluscans that produce neurotoxic venom in the form of small cysteine-rich…

Q: However, sugar cane and sugar beets are not the crops used to mass-produce ethanol; industry…

A: Fructose is a type of sugar known as a monosaccharide. Like other sugars, fructose provides four…

Q: . In a certain plant, the flower petals are normally purple.Two recessive mutations arise in…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Coronavirus from bats to animals, sequence comparison: Note: dots mean amino acid is the same as the…

A: Approach to solving the question: Detailed explanation: Question 1: To answer this question, we need…

Q: Make a concept map that includes the following terms: DNA, mRNA, protein - 10 site, - 35 site,…

A: These terms are related to formation of DNA copy (Replication), conversion of DNA to mRNA…

Q: Due to climate change, food security is highly compromised. Sequentially explain recombinant DNA…

A: Introduction :  The use of technology to alter or manipulate a biological system for human advantage…

Q: do selective pressures cause mutations? Yes or no, and please explain. What is the relationship…

A: Any cause for organisms with specific phenotypes to have a surviving advantage or disadvantage is…

Q: Introducing the recombinant lac operon/mouse tyrosinase DNA into mice is only half of the equation…

A: Regulating tyrosinase is a significant aspect in various biological processes, especially those…

Q: If the effects of mutations 1 +3 is an eye size intermediate between wild type and mutation 1 alone,…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Q38. The ΔF508 mutation of the CFTR gene is the cause of most cases of cystic fibrosis (CF). One…

A: Mutation in the Phe508 that is a deletion in the NBD1 domain of the CFTR protein is responsible for…

Q: Mitochondrial DNA is especially vulnerable to ROS. Suggest several DNA-protecting mechanisms that…

A: Mitochondria is a biological organelle that produces most of the ATP needed for the cell via the…

Q: MATCH THE FF. WITH THE CHOICES BELOW group of genes one long mRNA with complementary codes of 3 or…

A: The lac operon is a set of genes in bacteria (specifically, Escherichia coli) that is responsible…

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: The cyanobacterium Oscillatoria sancta appears reddish-brown when grown under green light but alters…

A: Cyanobacterium oscillatoria Sancta belongs to the genus of cyanobacteria. The organism is a large…

Q: True/false? if false, justify briefly Bacterial operons gather open-reading-frames that are coupled…

A: An operon is a group of few genes that are regulated under the same promoter and operator region.…

Q: The Na'vi of Pandora have a neuronal gene (Na'vi) product that undergoes extensive…

A: Transcription occurs in the nucleus. Transcription generates several kinds of RNA from DNA.…

Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…

A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…

Q: rue or False? Mutations are never introduced during normal cellular processes in the eukaryotic…

A: Mutation- is the change in the nucleotide sequence of a short region of a genome . Many mutations…

Q: Which statements are true? Explain why or why not.1 Each member of the human hemoglobin genefamily,…

A: The statements are well analysed and the answers are given below.

Q: construct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse…

A: The mouse used to explore the impact of a specific gene in the organism (mouse) is known as a…

Q: How could you detect horizontal gene transfer? Select all that apply. Finding a gene that strongly…

A: Horizontal and Vertical gene transfer: the genes that are transferred from one cell to another cell…

Q: If I am making 500ml of a solution with 0.625ml ITS, 0.0035ml Linoleic acid, 20ml Nu-serum, 0.75g…

A: A homogeneous mixture of two or more substances is referred to as a solution in chemistry when the…

Q: c) Recently, scientists have identified a mutation that is found at high frequency in Finnish…

A: Mutation can be defined as the alteration in the nucleotide sequences that are present in the genome…

Reproductive system infection

The biological process through which parents produce new children is called reproduction. A reproductive system is a group of internal and external organs that collaborate to allow males and females to reproduce. Many experts believe that the reproductive system is one of the most important systems in the body due to its crucial function in the survival of the species. Among the body's basic systems, the reproductive tract is the one that differs the most between sexes, and it is also the only one that does not operate until puberty.