Answered: Name two main steps which are…

Science

Biology

Name two main steps which are collectively referred to as down streaming process. Why is this process significant?

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter5: Biomedical Electronics: Digital

Section: Chapter Questions

Problem 12P

See similar textbooks

Related questions

Q: (r = 8 cm), respectively, construct a separation scheme for separating three subcellular structures…

A: Centrifuges are devices used to separate components dissolved in a fluid. They are used to separate…

Q: Describe upstream process.

A: A bioprocess is a method for producing desirable products having medicinal importance with the help…

Q: .. carbohydrates and glycolysis • Glycolysis: a mechanism you should know/ Aldolase 3. Hydroxyl beta…

A: Aldoses is the glycolytic enzyme that catalyzes the conversion of aldohexose carbon atom…

Q: Glucose 6-Pase is an enzyme present in liver cells but not in musc cells. The enzyme is bound to the…

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…

Q: Which patch clamp technique should be used if you want to investigate the effect a compound has…

A: The patch clamp technique - a laboratory technique. patch clamp technique used in electrophysiology…

Q: stages that involve in downstream process?

A: Downstream process is that the recovery and purification of biochemical product with correct…

Q: What does Mediator release?

A: Mediator release is an important process for body

Q: Glycolysis: a mechanism you should know/ Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) 2.…

A: Glyceraldehyde-3-phosphate dehydrogenase is a metabolic enzyme involved in the energy-releasing…

Q: Why is it reasonable to expect that control can be exerted near the end of a pathway as well as near…

A: The biochemical pathways comprise a wide variety of control mechanisms at many organizational…

Q: What is the passive process?

A: The cell membrane is a thin-semi permeable membrane that surrounds the cytoplasm of a cell. The cell…

Q: What is multiple-motor-unit recruitment? Explain the fivepossible results of multiple-motor-unit…

A: A motor unit is the word related to a single motor neuron and all of the muscle fibres that it…

Q: Self-corrective mechanisms in physiology------------are called loops

A: The phenomenon in which self-correction occurs in the physiology of a particular mechanism is known…

Q: Cite example of actions wherein the principle of double effect can be applied. Explain the coditions…

A: "Ethics is a collection of views about what is good and bad." Hippocrates introduced the concept of…

Q: Transduction: Describe the process of generalized transduction as a type of horizontal transfer. In…

A: Horizontal gene transfer is the process of swapping genetic material between contemporary or…

Q: Define transducer

A: There are various instruments that are used in biological sciences. These instruments are used for a…

Q: A particular error in the CFTR gene results in the replacement of the amino acid Phe with Ser at…

A: Cystic fibrosis is a type of autosomal recessive disorder which causes improper ion transport &…

Q: which of the following method(s) will give you the correct final concentration of dye?

A: Answer is D. only methods 1 and 4 are accurate.

Q: Dichotomous key:a. Convert the following dichotomous key into the flowchart version as described in…

A: The dichotomous word means two parts or divisions. A dichotomous key is a tool in microbiology that…

Q: Using two centrifuges (A and B), with maximum speeds of 1500 rpm (r = 8 cm) and 3000 rpm (r = 8 cm),…

A: Given that the three cellular structures need these respective g forces to get effectively separated…

Q: Celular Suid nipinephrine ed plasm G protein GOP D GTP Nucleus Adenylyl cyclase GTP CAMP-dependent…

A: The diagram shows the signal transduction of the hormone norepimephrine secreted from the adrenal…

Q: In this problem, you will design a filter system for a flow cytometer. The four fluorescent dyes are…

A: The order in which the filters are arranged with respect to the unfiltered signal is determined by…

Q: Arrange the following terms in order of decreasing specialization: oligopotency, pleuripotency,…

A: Cell potency is the ability of the cell to differentiate into another type of cell. The…

Q: r^2=6Dt , where D is the diffusion coefficient of thediffusing object and t is the time that the…

A: The objective of the question is to find out the time it takes for a protein to diffuse across a…

Q: Synaptic vesicles release into the synapse to give the message to the post synaptic neuron?…

A: Synapses: A synapse is a physical component of the nervous system that enables a neuron (or nerve…

Q: Independent of any possible effects of parasites, estimate the reduction in frog density caused by…

A: Let no trout, no parasite as pond 1 no trout, parasite as pond 2 trout, no parasite as pond 3…

Concept explainers

Spheres of physical activity

The spheres of physical activity experience include aspects of everyday life where physical activity is important. In general, the spheres recognize various purposes of physical activity in different contexts. The spheres of physical activity provide a broad basis for assessing the significance and prevalence of physical activity. There are seven spheres of physical activity experience.

Question

Name two main steps which are collectively referred to as down streaming process. Why is this process significant?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Cite example of actions wherein the principle of double effect can be applied. Explain the coditions that must be met in such action or situation.
Why is the placement of the trp operator important?
Glucose 6-Pase is an enzyme present in liver cells but not in muscle cells. The enzyme is bound to the endoplasmic reticulum which forms microsomes when the cells are hydrolyzed. Which of the following is the first critical step in isolating the glucose 6-Pase? A. Preparing the appropriate buffer for isolating the enzyme. B. Identifying the tissue from which to isolate the enzyme of interest and from which additional purification techniques can be applied. O C. Determining the appropriate method or reagent to lyse the cell O D. Obtaining the fraction from the cell which probably contains the enzyme. E. Determining the appropriate chromatographic method to remove contaminating proteins or other biomolecules
Ouabain is a specific inhibitor of the active transport of sodium ions out of the cell and is therefore a valuable tool in studies of membrane transport mechanisms. Which of the following processes in your own body would you expect to be sensitive to inhibition by ouabain? Explain your answer in each case. a) Facilitated diffusion of glucose into a muscle cell b) Active transport of dietary phenylalanine across the intestinal mucosa c) Uptake of potassium ions by red blood cells d) Active uptake of lactose by the bacteria in your intestine
A)Carrier of the activated amino acids to the ribosomes for incorporation into the growing peptide chain. B)Molecule that attaches to myosin and actin during muscle contraction. C)The reduced cofactor important in the TCA cycle and used in the last part of respiration. Please identify the terms.
Influenza viruses are surrounded by a membrane that contains a fusion protein, which is activated by acidic pH. Upon activation, the protein causes the viral membrane to fuse with cell membranes. An old folk remedy against flu recommends that one should spend a night in a horse’s stable. Odd as it may sound, there is a rational explanation for this advice. Air in stables contains ammonia (NH3) generated by bacteria in the horse’s urine. Sketch a diagram showing the pathway (in detail) by which flu virus enters cells, and speculate how NH3 may protect cells from virus infection.
What is an electrochemical gradient? What purpose does it serve?
What is a STEMI? What is the underlying mechanism of this?
Identify the structures in the following figure:
Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'
A mutation in the alpha globin gene that introduced one additional basic amino acid residue in the BPG binding pocket would: (select one) a) Eliminate Hb’s positive cooperativity. b) Decrease Hb’s O2 binding affinity. c) Increase Hb’s O2 binding affinity. d) Increase O2 binding in muscle and decrease it in lungs. e) Decrease O2 binding in muscle and increase it in lungs. f) It would have no effect on the adult form of Hb.
Draw schematic illustration and suggest the consecutive steps involved for Langmuir-Rideal mechanism.