Match the term with the best description meaningful sequence of nucleotides in a nucleic acid bacterial structure made of DNA: can be transferred horizontally from cell to cell typically circular in bacteria; contains a cell's essential genes. polymer whose monomers are nucleotides What does this expression mean? DNARNA Protein A. plasmid B. chromosome C. RNA D. ribosome E. genetic code F. gene ODNA first turns into RNA; then the RNA turns into a protein. A cell passes through a phase where it has only DNA, then only RNA, then only protein. The information in a DNA molecule is used to make an RNA molecule; then the information in the RNA is used to build a protein.

Match the term with the best description meaningful sequence of nucleotides in a nucleic acid bacterial structure made of DNA: can be transferred horizontally from cell to cell typically circular in bacteria; contains a cell's essential genes. polymer whose monomers are nucleotides What does this expression mean? DNARNA Protein A. plasmid B. chromosome C. RNA D. ribosome E. genetic code F. gene ODNA first turns into RNA; then the RNA turns into a protein. A cell passes through a phase where it has only DNA, then only RNA, then only protein. The information in a DNA molecule is used to make an RNA molecule; then the information in the RNA is used to build a protein.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 3VCQ: Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks...

See similar textbooks

Similar questions

It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
Process of translation *( Choose True if the statement is correct abourt genetic code and False if otherwise ) includes covalent modification of some proteins participation of rRNA transfer RNA is made from messenger RNA tRNA uses information from mRNA to produce amino acid chains
A crime has occurred, and you are asked to help solve it. A forensics detective brings you a sample from the crime scene of what they believe is the suspect's DNA and asks you for chemical analy Your study of this sample reveals the presence of adenine, thymine, ribose, and uracil, leading you to conclude that the sample is A pure DNA probably a mixture of DNA and RNA C pure RNA probably a mixture of rRNA and mRNA MAR 12 tv MacBook Air DII DD esc F6 F7 F8 F9 F10 F1 F1 F2 F3 F4 F5 &
Compare and contrast spliceosomes and ribosomes. Match each description to the correct structure. Spliceosomes produces mature mRNA Ribosomes Why might spliceosomes and ribosomes be so similar? Answer Bank composed of RNA and protein components has catalytic RNA Both catalyzes peptide bond formation Spliceosomes and ribosomes perform the same catalytic reaction. Both spliceosomes and ribosomes bind to RNA molecules at the same sequences. The catalytic RNAs of both are thought to have originated when RNA molecules served to store information and catalyze reactions. These structures were both obtained by eukaryotes through the process of horizontal gene transfer.
Antibiotics and Protein Synthesis Antibiotics are molecules produced by microorganisms as defense mechanisms. The most effective antibiotics work by interfering with essential biochemical or reproductive processes. Many antibiotics block or disrupt one or more stages in protein synthesis. Some of these are mentioned here. Tetracyclines are a family of chemically related compounds used to treat several types of bacterial infections. Tetracyclines interfere with the initiation of translation. The tetracycline molecule attaches to the small ribosomal subunit and prevents binding of the tRNA anticodon during initiation. Both eukaryotic and prokaryotic ribosomes are sensitive to the action of tetracycline, but this antibiotic cannot pass through the plasma membrane of eukaryotic cells. Because tetracycline can enter bacterial cells to inhibit protein synthesis, it will stop bacterial growth, helping the immune system fight the infection. Streptomycin is used in hospitals to treat serious bacterial infections. It binds to the small ribosomal subunit but does not prevent initiation or elongation; however, it does affect the efficiency of protein synthesis. Binding of streptomycin changes the way mRNA codons interact with the tRNA. As a result, incorrect amino acids are incorporated into the growing polypeptide chain, producing nonfunctional proteins. In addition, streptomycin causes the ribosome to randomly fall off the mRNA, preventing the synthesis of complete proteins. Puromycin is not used clinically but has played an important role in studying the mechanism of protein synthesis in the research laboratory. The puromycin molecule is the same size and shape as a tRNA/amino acid complex. When puromycin enters the ribosome, it can be incorporated into a growing polypeptide chain, stopping further synthesis because no peptide bond can be formed between puromycin and an amino acid, causing the shortened polypeptide to fall off the ribosome. Chloramphenicol was one of the first broadspectrum antibiotics introduced. Eukaryotic cells are resistant to its actions, and it was widely used to treat bacterial infections. However, its use is limited to external applications and serious infections. Chloramphenicol destroys cells in the bone marrow, the source of all blood cells. In bacteria, this antibiotic binds to the large ribosomal subunit and inhibits the formation of peptide bonds. Another antibiotic, erythromycin, also binds to the large ribosomal subunit and inhibits the movement of ribosomes along the mRNA. Almost every step of protein synthesis can be inhibited by one antibiotic or another. Work on designing new synthetic antibiotics to fight infections is based on our knowledge of how the nucleotide sequence of mRNA is converted into the amino acid sequence of a protein. Questions Why is targeting protein synthesis an effective strategy for preventing infection?
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna
Which is true about riboprobed ? contains complete sequence to targeted mrna contains molecular label pictures hich distinguish them from cellular RNAs ability of penetrate most cells All above none above
Match the descriptions to the molecules of transcription and translation. MRNA [ Choose ] v DNA [ Choose ] FRNA [ Choose ] TRNA [ Choose ]
Which of the following is the prokaryotic helicase? DnaB DnaD DnaA DnaC
Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'
Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm takes place Process of transcription takes place Process of copying DNA takes place
TRANSLATION (RNA to _) take place on the DNA, Ribosome, cytoplasm DNA, nucleus, cytoplasm Proteins, Nucleus, ribosome Proteins, ribosomes, cytoplasm and in the