lacz gene lacP (promoter) lac repressor ТАСССАCСССАСССттТАCACTTTATCCTTCCCстсстАтсттстстссAАТтстсAССССАТАAСлліTICAC -35 region (consensus sequence) Transcription Operator bound start site -10 region (consensus sequence) 16.8 In the lac operon, the operator overlaps the promoter and the 5' end by lac repressor of the first structural gene. im in in in

Q: The RNA strand is complementary with the template strand. What makes the RNA 'leave' the DNA so that…

A: RNA polymerase Is responsible for the RNA 'leave' the DNA so that they do not stick together.  The…

Q: Watch the following video called "Human Genome Project Video"…

A: Decoding the human genome has provided a wealth of information that is revolutionizing medicine,…

Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…

A: It is an alteration in the nucleotide sequence of the genome of an organism.

Q: The red line indicates where a radioactively labeled probe hybridizes. Three samples of the genomic…

A: P                      B                         PB…

Q: A DNA strand has the following sequence:      5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…

A: BASIC INFORMATION  RESTRICTION ENZYME  they are also known as molecular scissors it was in the year…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: One common type of non-homologous end joining, to repair a double stranded break, occurs when…

A: Introduction  Non-homologous refers to two or more structures or sequences that do not share…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…

A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…

Q: X Review Chargaff's conclusions (see slide) to answer this question. DNA extracted from bacteria was…

A: The values of guanine and adenine are equivalent to quantities of cytosine and thymine.

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…

A: Cells are the most fundamental and essential unit of life in all living things. All of life's…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.