In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is Select one: O 1. log2(n) O 2. nlogn O 3. n O 4. None of above
Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…
A:
Q: DNA molecules with compatible sticky ends can be joined together by Select an answer and submit. For…
A: dna is the genetic material . it is a polymer of nucleotides , which are formed by nitrogen base ,…
Q: What would be the final primer concentration if 0.5 ul of 10 uM primers were ad a PCR reaction with…
A: Introduction: A primer is a short strand of DNA or RNA that is usually about 18-22 bases and serves…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: Refer to the attached DNA model. In the spaces provided on the attached table, identify the…
A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…
Q: If you amplify a single double-stranded (ds) DNA template molecule using 25 PCR cycles, how many ds…
A: The polymerase chain reaction is a method for cloning a particular piece of DNA to make virtually…
Q: Which of these is not a tool for comparing DNA sequences? PLINK Fasta BLAST A dotplot e.g. dotlet
A: DNA polymerase is an enzyme. A primer is a single-stranded DNA fragment that binds to template DNA…
Q: Suppose there are three tubes containing following samples in the laboratory. The three tubes are…
A: DNA(deoxyribonucleic acid) is defined as the building block of life because it carries all the…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: Indexing of genome is done in order to index all the small sequenes within the large genome.The…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file? The data quality is…
A: The data quality is too low and the data is noisy
Q: L 1 2 3 Locus A Locus B L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene %3D…
A: The biotechnology is a branch of biology that deals with different techniques that help…
Q: Which of the following is most needed to determine the DNA quantity using the eyeball method? A DNA…
A: DNA quantity was determined by several methods where absorbance was one of the widely used methods…
Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…
A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…
Q: Which of the following approaches you can use to locate the relative positions of genes on…
A: Genes are located on chromosomes. These genes can not be targeted without using any specific gene…
Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…
A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…
Q: In order to determine the purity of a DNA sample, spectrophotometry can be carried our at Answer to…
A: Spectrophotometry is the quantitative analysis of spectra to compare the relative absorption or…
Q: In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging…
A: The fragments of DNA synthesized by DNA polymerases during lagging strand synthesis are described as…
Q: Which enzyme is used in Sanger sequencing reactions? O A. DNA polymerase O B. S1 endonuclease O C.…
A: Introduction :- Sanger DNA sequencing is commonly employed in research to target smaller genomic…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality…
A: The most commonly used tool for detecting SNVs is Sanger sequencing, it involves DNA polymerase…
Q: When working with the gel electrophoresis chamber, what must we keep in mind? A. Keeping the gel…
A: Gel electrophoresis technique of separation of molecules on the basis of their size and charge under…
Q: When running a gel during a Sanger sequencing, the following results were obtained: I I Find the DNA…
A: Sanger sequencing is a technique which is used to determine the order of the four nucleotide bases…
Q: The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules from nucleoside…
Q: A DNA sample was sent off for Sanger sequencing. The results are shown below. What is the sequence…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: Based on the following image: A) Identify the largest DNA fragment in sample 5. Explain your…
A: In the given question, an agarose gel is shown which is having bands of DNA in different lanes. DNA…
Q: Single stranded binding protein A coats ss DNA to keep it single stranded b bind double…
A: Single-strand DNA-binding protein (SSB) is a protein found in Escherichia coli (E. coli) bacteria.…
Q: In this diagram of a DNA electrophoresis gel, which sample contains the smallest molecules? АВСD в с…
A:
Q: Which of the following is TRUE with respect to electrophoresis? a. DNA is not attracted to either…
A: Electrophoresis is defined as the motion of dispersed particles relative to a fluid under the…
Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…
A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…
Q: 100 F В A 75 80 85 90 95 100 105 110 115 120 125 Temperature (°C) A) What is the tm of the most…
A: DNA is a double-stranded helical molecule. The monomer of DNA is a nucleotide. A nucleotide…
Q: What is a DNA Ladder? a solution added to a DNA sample to give it color for an electron microscope.…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: An individual’s unique set of_______ can be used in DNA profiling. a. DNA sequences c. SNPs b. short…
A: Introduction In the genome, there is usually two types of nucleic acid sequence present. One is…
Q: What is a DNA Ladder?
A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…
Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…
A: Restriction enzymes The enzyme that is use to cut the DNA at specific site.
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: Given wheat 200 milligram germ extraction volume. = 500 microlitre Sample used for analysis=…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA generally stands for Deoxyribonucleic acid It is generally double standard Purine and…
Q: You have two DNA samples, A and B. A 1/10 dilution of sample A had an absorbance at 260nm of 0.12. A…
A: Nucleic acids strongly absorb UV light with wavelengths of 260 nm due to the resonance structure of…
Q: Which of the following DNA has a high G-C content? (Tm refers to the melting temperature of the DNA.…
A: In double stranded DNA the adenine binds with thymine and guanine binds with cytosine. This four…
Q: (AKS 8a2, DOK 1) A gel from gel electrophoresis is shown below B. Which DNA Fragment is the…
A: Gel electrophoresis is an analytical technique which is used for the separation of DNA; RNA and…
Q: Humans have very similar DNA sequences, with approximately 999/1000 letters being One possible way…
A: The human genome is a complete collection of nucleic acid sequences for humans, encoded as DNA in…
Q: The 260/280 ratio of pure DNA is between 1.8- 35 2.0. The absorbance of DNA at different 30…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: Which of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue…
A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…
Q: Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I…
A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…
Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…
A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…
Q: The rate of migration of DNA within an agarose gel in the gel electrophoresis technique is dependent…
A: Agarose gel electrophoresis: It is used for the separation of DNA molecules that are larger than…
Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…
A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does…
A: Polymerase chain reaction (PCR) is a technique used to produce a large number of copies of a…
Step by step
Solved in 2 steps
- ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…Available (C hope this picture, https:://www.phys.ksu.edu/gene/photos/sd.html,e will help you imagine the results for platelule 11 Making Cells – 202 Bb Module 11 Making Cells - 2021 X Bb Take Test: "Lab 11 Homework - X + A sunyocc.open.suny.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_109869_1&course_id=_53817_1&c Question Completion Status: D. Organelle A. Two identical that builds copies of DNA microtubule "highways" to guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers MacBook DD 00 000 F8 F6 F7 F4 F5 F2 F3 F1 * $ % & @ # 2 3 4 * CO < O
- erm test Fall 2020 (page 1 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149 -aming System (Academic) Fon 3 "DNA is passed from one generation to another during cells division after DNA replication". et red which of the following statements regarding DNA replication is NOT correct: d out of Select one: O a. Each DNA strand of the double helix will be copied g question O b. The newly synthesized strand will have the complementary sequence of the parental template strand O c. The daughter cell will have doub the amount of DNA that the parental cell had n 4 Which of the following ketoses contain the same number of carbons as glucose? ed Select one: out of O a. Sucrose O b. Fructose question O c. Ribose O d. Galactose O e. Aldose 5) helps maintaining the skin's cells and prevents the growth of somet (5 a 1 dao) - Google Chrome edu.om/mod/quiz/attempt.php?attempt=2334320&cmid=1127808 SQU E-LEARNING SYSTEM (ACAI الوقت المتبقي 0.175mm .e O In the DNA extraction experiment, the separation of DNA from its packaging protein can be achieved by the addition of Detergent aO 1.00 Salt b O هذا السؤال Ethyl alcohol cO Papain powder .d O Cold water Le O In paramecium, osmoregulation occurs through 3 Activate Windowssk Macronucleus Goaotings to acttivate do nere to search 6. 70°F Mostly sunny 9:05 ENG 12/18 f2 O f3 O f4 O f6 O f8 end f7 0 F10 insert f9 D F12 T num IA break @ %24 & 8 2 3 r 4 5 6 7 8 A 9 9 R Y ! U S F G J K +|| 回 Q 以 4Available whis.picture. https://www.phys.ksu.edu/gene/photos/sd.html.g will help vou imagine the results for plate
- Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتبersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ONAo三 Normal No Spacing Hea A- = = =国位。|鱼 三、 、■ Styles Paragraph Section B: Circular DNA [12] Eco01091 2698 Pfol 46 BstAPI 179 Aatil 2641 Sspl 2525 Ndel 183 Ehel 235 Pdml 2318 396 MCS lacz lac. 146 2510 Bcgl 2239 Scal 2201 236 476 493 PUC57 2710 bp BsaX 683 Sapl 707 2/6 Afll, Psel 830 Gsul 1808, Cfr101 1803. Eco311 1790. Eam11051 1718 1650 1400 rep (PMB1) BseYl 1134 Cail 1241 CAFT TR Lad l The d Mat The M 1. You have a circular plasmid (pUC57) which consisrs of 2710 bo. What would the number and length of the fragments be if you cut the plasmid wih the following essibility: Investigate 52 OO C a bla (Ap) EGO
- 8 points total. Within the general field of biotechnology, DNA technology uses modern laboratory techniques for the studying and manipulation of genetic material. Explain how DNA might be sequenced, analyzed, and "cut and pasted" as DNA technology is employed. In addition, outline one way in which DNA technology could be employed to improve human lives. I 3☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)O Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak local