In the holo-RNA polymerase, the subunit will interact with the UP element of target genes. Select one: O a. sigma (o) subunit O b. omega (w) subunit Oc. beta (B) subunit O d. alpha (a) subunit
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…
A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…
Q: A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho…
A: Transcription is the transcribing DNA into mRNA with the help of RNA polymerase. Rho factor are…
Q: If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing…
A: Alternative splicing is the process of splicing different combinations of splice sites with a…
Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…
A: Transcription is process through which DNA is converted into mRNA.
Q: Define the following terms: a. promoter b. consensus sequence c. operon d. chromatin-remodeling…
A: Molecular Biology is the broad term under which all these above-mentioned terms are discussed.…
Q: Shown below is diagram of RNA polymerase undergoing the process of transcription: This transcript:…
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…
A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…
Q: ollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the…
A: mRNA is the polymer of nucleotides formed by the process of transcription using the DNA template…
Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…
A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…
Q: Complete each of the following statements by selecting from the bank of terms below. a. tRNA b.…
A: 81)Redundancy 82)Universal 83)Elongation 84)Promotor 85)RNA processing 86)snRNA 87)tRNA
Q: In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments.…
A: In 1964 Nirenberg and Philip Leder, a postdoctoral fellow at NIH, discovered a way to determine the…
Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: transcription should be done from the 5' DNA chain. 1. a. 3' DNA: b. 5' DNA: c. mRNA: d. Amino…
A: This exercise involves the process of replication, transcription and translation. In the process of…
Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…
A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…
Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…
A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: Which of the following statements is/are TRUE for transcription? A. RNA polymerase uses one strand…
A: Transcription is the process in which RNA is synthesized from DNA. This process involves certain…
Q: A segment of template DNA is known to contain the following base sequence: 3'…
A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of…
A: DNA is a self-replicating molecule. The process by which mRNA is produced from DNA is called…
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…
Q: Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each…
A: * Gene activation and inactivation are the complicated and multistep which are the controlled…
Q: Choose the item in column 2 that best matches each item in column 1. A. Provides information for…
A: core RNA polymerase - multi subunit enzyme composed of 5 subunits : 2α , β , β' and omega. RNA…
Q: Which of the following is not true? A.) A single activating enzyme can interact with all the tRNAs…
A: The 'activating enzyme' mentioned in option 1 is aminoacyl tRNA synthetase. Aminoacyl tRNA…
Q: 0 = P
A: Drugs used for HIV from using the reverse transcriptase enzyme to replicate. Reverse transcriptase…
Q: Describe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Step by step
Solved in 2 steps
- DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template strand 5' AATGCACGGCTAGCTT 3' non-template (or 'coding') strand a. Transcribe it to MRNA (write your answer in the text box with no spaces and starting at the 5' end of the MRNA, like this: ccaggcaa...) b. Using the reading frame that begins with a start codon, what polypeptide will this mRNA produce? (write your answer using the three letter amino acid codes, separated by a hyphen but without spaces, like this: phe-leu-thr-ser..) Second MRNA base A G UUU Phe UGU 1 Cys UCU UAU Тyr UUC Ucc UAC UGC Ser UUA UCA UAA Stop UGA Stop A Leu G UUG UG UAG Stop UGG Trp CUU CcU CCU CAU 1 CGU His cc CÁC CGC Leu Pro Arg CUA CCA CAA CGA Gin CUG cCG CAG CG G AUU ACU AAU AGU Asn Ser AUC lle ACC AAC AGC Thr AUA ACA AAA AGA Lys Arg Mot or AUG ACG AAG AGG start GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG First MRNA base (5' end) Third mRNA base (3' end)the following is a strand of a DNA
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projections
- The sequence below (A) was read from the autoradiogram (B). (A) 5' TGTACAACTTTTACTTAGGGCCGTGACACCTAAAG. 3' (B) Negative end ACGT Positive end C. Compare the sequence to the autoradiogram. How is the sequence read? Explain your ans d. Suppose that you want to express the correct protein product of an eukaryotic gene in a bacterial cell using a plasmid vector. What single sequence related factor must your consider in the cloning experiment?The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
- 4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3' b) How many different mRNA sequences could code for the protein sequence you determined in 4a? Explain how you came up with your answer (don't write out all the possible mRNA sequences - just explain your logic). Can you help with 4a and sub question b1 2 3' ACGACCAGTAAA 5' 9. How many codons are there above in question 8? Label one of them in green. 10. What event is coded for by UAA, UAG and UGA? 11. What is the start codon? 12.Describe the steps: initiation, elongation, termination, that occur during transcription. a. initiation b. elongation C. termination 13. What is the TATA box? 14. RNA processing, sometimes also called MRNA editing, occurs only in eukaryotic cells. Prokaryotic cells lack the enzymes to edit MRNA. The primary transcript is altered at both ends, and sections in the middle are removed.Briefly describe two of the tree functions of RNA polymerase