In the boxes below, complete the DNA Replication and Transcription.

Q: Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch…

A: DNA is a biomolecule present in the eukaryotic nucleus. It is made up of nucleotides.

Q: Explain The DNA Code in 200-300 words.

A: Please follow step 2 for detailed explanation.

Q: List and explain three reasons why DNA replication is very accurate.  Is this true for both…

A: Introduction: Replication is a process by which each strand of the dsDNA is duplicated into a…

Q: Give typing answer with explanation and conclusion What is the complete base composition of a…

A: Fouble-stranded DNA, is a DNA molecule consisting of two complementary strands that are intertwined…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…

A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: Name of a few enzymes involved in DNA replication other than DSNA polymerase and ligase.name the key…

A: Each cell follows central dogma to undergo division and growth. The central dogma has three main…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: What is the sequence in the template DNA strand during RNA production that encodes the codon GCU?…

A: Translation is the process of formation of mRNA transcript on DNA template strand.

Q: Write TRUE/FALSE in number 6,7,8,9,10 ____6. “ Prokaryotic ribosomes is made of 40S and 60S…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: All eukaryotic DNA is located in the nucleus. Determine whether the statement is True or False. And…

A: Eukaryotes have true nucleus. It means the nucleus is surrounded by nuclear membrane which contains…

Q: Draw a nucleosome, indicating the positions of DNA andproteins.

A: All organisms have genomes that are very large in comparison to the size of their cells. The large…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: Choose the correct answer from the list. is a DNA binding site. protects coding sequences at the 5'…

A: All these terms are related to synthesis of biomolecules by the processes such as transcription and…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: List the DNA polymerases in prokaryotes and eukaryotes .

A: DNA polymerase is an enzyme that catalyses the synthesis of DNA and replication of DNA .

Q: Consider how histone proteins bind to DNA and then explain why a salt solution with a high…

A: DNA is deoxyribonucleic acid and is composed of two chains of the polynucleotide. These coil around…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Please read the scenario below and then answer the question (in bold) that follows. An original DNA…

A: The original DNA sequence is  3'-GGCGCTAGAATC-5'. A mutated version of that DNA strand is…

Q: Explain how cells activate nucleic acids for polymerization.

A: Nucleic acids are polymers  themselves. A macromolecule such as a nucleic acid or protein is…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: Give typing answer with explanation and conclusion    draw a simple diagram showing the enzymes…

A: Baltimore classified different viruses according to the manner by which mRNA is synthesized.…

Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…

A: Please follow step 2 for detailed explanation.

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: 1. What are the amino acids translated from the resulting mRNA?

A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: Explain linker domain

A: In order to stay intact in cells, some proteins occur in complex with the binding partners They…

Q: Draw replication forks that show what you would expect to see if a cell were unable to make the…

A: Replication is the process of synthesis of new DNA strand from the existing ones. The existing DNA…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.