In a double-stranded DNA molecule, how are the sequences of each strand related to each other?   A The sequences are identical.   B The sequences are identical except that one strand has a U where the other strand has a T.   C The sequences are the reverse compliment of each other and use the nucleotides, A, G, U, and C only.   D The sequences are the reverse complement of each other.

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: Okazaki fragments are short DNA pieces that explain how

A:

Q: Question 4 A protein spike of a virus has been identified as an important characteristic of the…

A: Given: The spike protein of a virus has been identified as an important characteristics of virus and…

Q: QUESTION 13 The corresponding strands of DNA are said to be? O a. Complimentary O b. Oppositely…

A: Watson and crick's model of DNA structure is the most widely accepted model. DNA is the long polymer…

Q: Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to…

A: Agarose gel electrophoresis is a commonly used laboratory technique to separate the charged…

Q: The two strands of DNA are O antiparallel. O parallel. O even. O share the same ends.

A: DNA is made up of two strands and both strands are anti parallel to each other.

Q: Questión 13 Which of the following DNA parts actually refers to a six -membered heterocyclic ring? A…

A: DNA and RNA are macromolecules that make up nucleic acid. DNA (Deoxyribonucleic acid) is a genetic…

Q: Question 3. It is not necessary to take precautions against shearing RNA during the purification…

A: RNA molecules are more prone to shearing than DNA due to their single stranded nature & smaller…

Q: Very carefully analyze each nucleotide structures (base and sugars) and identify the structure(s)…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: A sample of double-stranded DNA contains 20% adenine. Approximately what percent of the nucleotides…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: QUESTION 31 Match the type of bond with the role below: phosphodiester a. joins adjacent nucleotides…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Question 6 The helical turns of the DNA does not only provide spaces for binding with regulatory…

A: Introduction: RNA and DNA are the two types of nucleic acids. The nucleic acid serves as a…

Q: Question 18 Which of the following holds together the complementary bases in the DNA and in the…

A: The complementary bases in the DNA structure are bind together with the help of hydrogen bonds ,…

Q: You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC…

A: Assembly involves taking a large number of DNA reads, looking for areas in which they overlap with…

Q: Question 2. Ribosomes are cellular structures that are composed of protein and RNA; this structure…

A: Ribosomes are small structures found in all living cells that are responsible for protein synthesis.…

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O…

A: Introduction:- DNA ( Deoxy-ribonucleic acid) is a polymer of deoxy-ribonucleotide units, they are of…

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: The triplet code allows many amino acids to be specified by more than one codon. Such a code is said…

A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…

Q: Question #26 PTP1B, in the lab. You just performed a protein purification and are about to run an…

A: The average molecular weight of an amino acid is 110Da. 300 residue MW. 300x110=33000Da=33kD…

Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…

A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.

Q: The bacterial repair system that corrects mismatched bases after polymerization is able to…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: Question 2. Bacteria are grown in a medium containing 15NH₂Cl for a number of generations so that…

A: The give case in the question belongs to experiment conducted by Meselson and Stahl who demonstrated…

Q: Question 11 The triplet code allows many amino acids to be specified by more than one codon. Such a…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: QUESTION 9 The function of DNA polymerase in the process of DNA replication is , O a. to prevent the…

A: Answer: The function of DNA polymerase in the process of DNA replication is b. to catalyze the…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…

Q: QUESTION 21 Observation of purified DNA as "beads on a string" first indicated the presence of: а.…

A: DNA is considered as the genetic material, which helps to control all the functions of the cell. In…

Q: Question 6 Which of the following is true of the base content of dsDNA? A moles of thymine = moles…

A: There are four nitrogenous bases of DNA which are Adenine,  Guanine, thymine, and cytosine.  Guanine…

Q: QUESTION 20 Which of the following polymerases is found in the nucleolus? O A. DNA polymerase III O…

A: Polymerase enzyme is responsible for the process of polymerizing the monomers into polymers.

Q: QUESTION 13 The two strands of a DNA molecule are held together by hydrogen bonds between the O…

A: DNA is a genetic material, which contains all the information.

Q: If the 3 proteins in the blue sample had MW's of [1] 87,000 Daltons, [2] 30,000 Daltons, [3] 15,000…

A: Gel electrophoresis is a technique used in molecular biology to separate biomolecules such as DNA,…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity.  Complementarity is…

Q: What is the most stable nitrogenous base pairing?

A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…

Q: The Watson-Crick double helix immediately suggested that DNA is replicated in a manner. a. semi…

A: The genetic material is transmitted to the next generation through DNA. A cell leads to several more…

Q: 33. Which defines a codon?  A. a protein that beins transcription by breaking apart H bonds  B. a…

A: Codon  A nucleotide, in turn, is made up of a nucleobase or simply, base, a sugar, and a phosphate…